We narrowed to 26,938 results for: cas9 genes
-
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA17 (FWA)
Plasmid#120250PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg17_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJB172
Plasmid#86992PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1DepositorInsertgRNA targeting pil1
ExpressionYeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGM55273
Plasmid#153211PurposeLevel 2 cloning vector for a single guide RNA, already contains Cas9, Kanamycin selection cassette for plant transformation and FAST markerDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
tdTomato/pTREX-b
Plasmid#68709PurposeExpresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.DepositorInserttdTomato
UseExpression of tdtomato red fluorescence protein i…Available SinceOct. 8, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDonor-tBFP-NLS-Neo
Plasmid#80766PurposeCustomizable donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorTypeEmpty backboneUseCRISPRTagsTagBFP2-3×NLSExpressionMammalianAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAGM65881
Plasmid#153215PurposeLevel 2 cloning vector for one or several guide RNAs, already contains Cas9 and a kanamycin selection cassette for plant transformationDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRB14
Plasmid#52522Purposeexpresses a myc-tagged version of hCas9 in DrosophilaDepositorInsertS. pyogenes cas9 with humanized codon bias
TagsmycExpressionInsectPromotertubulinAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLC133
Plasmid#198639PurposeExpression plasmid for dCas9 in E. coli used in Chip-seq experiments. dCas9 is tagged with a C-terminal 3x FLAG tag. A guide RNA can be cloned using BsaI restriction sites.DepositorInsertdCas9
Tags3x-FLAGExpressionBacterialPromoterpTetAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAGM55297
Plasmid#153213PurposeLevel 2 cloning vector for a single guide RNA, already contains Cas9, Kanamycin selection cassette for plant transformation and FAST markerDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only