We narrowed to 9,135 results for: sgRNA
-
Plasmid#90914Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorInsertTOP2A (Guide Designation G11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLK1 G5.1 gRNA
Plasmid#90834Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorInsertPLK1 (Guide Designation G5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CENPF C5.1 gRNA
Plasmid#90616Purpose3rd generation lentiviral gRNA plasmid targeting human CENPFDepositorInsertCENPF (Guide Designation C5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AspFlex Kit
Plasmid Kit#1000000217PurposeCollection of standardized parts for protein expression analyses and CRISPRi experiments in Acinetobacter sp.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden Gate (MoClo)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-ACTB
Plasmid#183868PurposeRepair template for the N-terminal tagging of beta-actin with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertACTB homology arms with mRuby2-linker (ACTB Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-RHOA
Plasmid#183836PurposeRepair template for the N-terminal tagging of RhoA with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertRHOA homology arms with mNeonGreen-linker (RHOA Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir451 EF1Alpha-puro-T2A-BFP
Plasmid#164792PurposeExpress miR-451 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST Halo-flag-CAD
Plasmid#188117PurposeExpresses N-terminal Halo-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tag and Halo tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
RNA-Binding Protein Pooled CRISPR Knockout In Vivo Library
Pooled Library#250988PurposeCRISPR knockout library targets 206 RBPs with 5 single-guide RNAs (sgRNAs) per target. It is constructed in the lenti-CRISPR V2 backbone, enabling doxycycline-inducible expression of Cas9.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
Liu Lab MusCK Library B
Pooled Library#174197PurposeMusCK library contains 23,622 unique sgRNAs targeting 4,787 gene locations in the genome. Sub-library MusCK M_b contains 5 gRNAs per gene.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-1
Plasmid#129053Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129036Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA8 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129029Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCsy-crRNA-EV
Plasmid#153944PurposeFor cloning and expression of Type I-F P. aeruginosa (PaeCascade) crRNA in mammalian cellsDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129048Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA8 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_FANCF-EGFP
Plasmid#159785PurposeS. pyogenes pegRNA for C to A mutation at the FANCF site of human cells using prime editingDepositorInsertspacer of pegRNA targeting FANCF gene (FANCF Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1846
Plasmid#154326PurposeMulti-cassette for SapTrapDepositorInsert30aa linker::GFP^SEC^AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-evoA1-seBEN_empty
Plasmid#174701PurposeSmall-molecule controlled base editingDepositorInsertLenti-evoA1-seBEN
UseLentiviralTagsmyc tagPromoterEFS/U6Available SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only