We narrowed to 16,609 results for: grna
-
Plasmid#137879PurposeDonor vector for integration into the human AAVS1 safe harbor locus of Doxicycline-inducible KRAB-dCas9-IRES-EGFPDepositorInsertTRE3G-KRAB-dCas9-IRES-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_887
Plasmid#201164PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' p65 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2519
Plasmid#91076PurposeModule B, Promoter: OsU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterOsU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry
Plasmid#78534PurposeBackbone to clone single or paired sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA)Available SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRDA_886
Plasmid#201162PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' VP64 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2518
Plasmid#91075PurposeModule B, Promoter: TaU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2515
Plasmid#91072PurposeModule B, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa2
Plasmid#79005PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 2.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23A
Plasmid#91138PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEasyCas9
Plasmid#184909PurposeExpresses the Streptococcus pyogenes Cas9 proteinDepositorInsertCas9
UseCRISPRExpressionBacterial and YeastAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
1154B_gFLE_pB_VTK_ActG
Plasmid#187238PurposeAn. gambiae transgenesis plasmid. PiggyBac with transposase in backbone. Expresses two gRNAs targeting fleDepositorInsertFemaleless
UseCRISPRExpressionInsectAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRDA_888
Plasmid#201165PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' p65, HSF1 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1-Scr
Plasmid#133042PurposeSiC-V1 vector with scramble (Scr) sgRNA. This lentivirus construct is used for stably expressing spCas9 with a dTomato reporter in a cell line of interest.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
dCas9 fused to scFv (anti-spike)
Plasmid#186421PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing spike protein from SARS-CoV-2DepositorInsertdCas9-scFv fusion (anti-SARS-CoV-2 spike)
UseCRISPRTags6HisAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459-APP-KO
Plasmid#176487PurposeTo knockout APP geneDepositorInsertgRNA sequence
UseCRISPRAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_10A
Plasmid#91207PurposeDirect Cloning, Type: non-T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: noneDepositorInsert35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only