We narrowed to 16,278 results for: nes
-
Plasmid#214532PurposeAiE2389m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1774 - pAAV-AiE2449m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214540PurposeAiE2449m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1333 - pAAV-AiE2115m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214484PurposeAiE2115m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1492 - pAAV-AiE2004m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214501PurposeAiE2004m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1332 - pAAV-AiE2114m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214483PurposeAiE2114m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-PIP4K2C
Plasmid#202730Purposeexpresses fluorescent protein-tagged enzymeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmTagBFP2:PIP4K2C (PIP4K2C Human)
ExpressionMammalianAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pCK033 p5E desma MCS
Plasmid#195948PurposeGateway p5E vectorDepositorInsertdesmin a regulatory elements (desma Zebrafish)
UseOtherAvailable sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-TIR1/Pur
Plasmid#171682Purposeconstitutive expression of TIR1-myc in sleeping beauty transposon vector with selection marker (puromycin)DepositorInsertOsTIR1-MYC
TagsMYCExpressionMammalianPromoterEF-1a promoterAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_CD19.4
Plasmid#140101PurposeCRISPR-Cas9 Knock downDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralAvailable sinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-sbGLuc-B7-EYFP
Plasmid#114110Purposefusion protein of Gaussia luciferase variant slow burn, B7 transmembrane region, and enhanced yellow fluorescent protein; control for bioluminescent optogeneticsDepositorInsertsGaussia luciferase, slow burn
B7 hinge region
Enhanced Yellow Fluorescent Protein
UseAAVExpressionMammalianAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMPC2_7
Plasmid#163457Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 7 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiCRISPR-v1-sgMPC2_9
Plasmid#163458Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 9 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_HOXB6_P2A_Hygro_Barcode
Plasmid#120454PurposeBarcoded lentiviral vector to express HOXB6 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#2/Cre
Plasmid#89650PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-zfh1
Plasmid#86381PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster zfh1 enhancer
UseStap-seq screening vectorAvailable sinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only