We narrowed to 8,715 results for: LIC
-
Plasmid#201709PurposeExpresses of mcherry-tagged mTet1-ZF-CD in mammalian cellsDepositorInsertTet1-ZF_CD (Tet1 Mouse)
TagsmCherryExpressionMammalianMutationZinc finger domain of Tet1 fused to its catalytic…PromoterCAGAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-ePhi29(+exo) (LM2995)
Plasmid#208966PurposeUnfused ePhi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(+exo)(M8R/V51A/M97T/G197D/E221K/Q497P/K512…PromoterCMV and T7Available SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-ePhi29-CC(N5) (LM2719)
Plasmid#208973PurposeRecruited ePhi29 DNA polymerase (-exo), with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertePhi29-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(-exo)(D169A;M8R/V51A/M97T/G197D/E221K/Q497…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 43-372
Plasmid#205054PurposeTWNK protein expressionDepositorInsertTWNK (TWNK Human)
ExpressionBacterialMutationLacks Mitochondrial localization signal and C ter…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 360-684
Plasmid#205055PurposeTWNK protein expressionDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-6xHis-TEV-Nsp8(76-198)
Plasmid#201024PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 residues 76-198, with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam_AG
Plasmid#148831PurposeBacterial Expression of DmBamDepositorInsertDmBam (bam Fly)
ExpressionBacterialMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmBam_AA
Plasmid#148287PurposeInsect Expression of DmBamDepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmBam_AA
Plasmid#148289PurposeInsect Expression of DmBamDepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-MS2-HA-C1-DmBam_AG
Plasmid#148837PurposeMammalian Expression of DmBamDepositorInsertDmBam (bam Fly)
ExpressionMammalianMutationone non silent mutation A239 to S, described as …Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-DmBam_AG
Plasmid#148840PurposeMammalian Expression of DmBamDepositorInsertDmBam (bam Fly)
ExpressionMammalianMutationone non silent mutation A239 to S, described as …Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIS_TEV_hsSYX3
Plasmid#179290PurposeE. coli expression plasmid (T7lac promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + TEV protease cleavage siteExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7lacAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP-MIOX
Plasmid#166682PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase fused to VP2C-GFP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFP
Plasmid#166674PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only