We narrowed to 2,224 results for: PAM
-
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGY150
Plasmid#249722PurposepGY150 is a CRISPR adenine base editing vector with the nickase variant of SpCas9-NG (nCas9-NG) and an sgRNA cassette, enabling targeted A-to-G conversions at flexible NG PAM sites in filamentous fungDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY151
Plasmid#249723PurposepGY151 is a CRISPR cytosine base editing (CBE) vector with the nickase variant of SpCas9-NG (nCas9-NG) and an sgRNA cassette, enabling targeted C-to-T conversions at flexible NG PAM sites in filamentoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAGK43
Plasmid#222223PurposeEdits NPAS2 Gene.DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
CSM160
Plasmid#105684PurposePlasmid containing an RFP dropout used to construct randomized PAM libraryDepositorInsertRFP Golden Gate dropout
ExpressionBacterialPromoterBba_R0040 TetR PromoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
hJAM-A pcDNA3.1
Plasmid#70073PurposeExpresses human junctional adhesion molecule-A in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV eGFP hPGK BSD
Plasmid#188519PurposeBackbone for CRISPR activation (CRISPRa) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT01
Plasmid#223373PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT11
Plasmid#223383PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-eA3AmaxNG-BlastR
Plasmid#152999PurposeC-to-T base editor, NG PAMDepositorInserteA3A-nSpCas9 NG-UGI-UGI
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS30: pTarget(PmcCAST)
Plasmid#168163PurposeTarget plasmid containing PmcPSP1 and attachment site for PmcCAST.DepositorInsertsPAM for PmcCAST + PmcPSP1
tRNA-Val
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
EFS eGFP hPGK BSD
Plasmid#188520PurposeBackbone for CRISPR interference (CRISPRi) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only