We narrowed to 72,050 results for: nin
-
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pERM2-nhpSer
Plasmid#201922PurposeEnables translational incorporation of non-hydrolyzable phosphoserine into proteins at TAG codons in E coli. Do not use for phosphoserine incorporation.DepositorInsertsSepRS(2)
Sep-tRNA v2.0
SerB
EF-Sep
TagsNoneExpressionBacterialMutationE412P, E414F, T417K, P495M, I496W, F529S and H67R…PromoterGlnS (constitutive), OXB20 (constitutive), lpp (c…Available SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
APOE_pLX307
Plasmid#98317PurposeLentiviral expression of APOEDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin
Plasmid#118710PurposeLentiviral TET-ON inducible GFP-ProgerinDepositorInsertGFP-Progerin (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA-GFP
Plasmid#215489PurposeLentiviral expression and easy visualization of alpha-synuclein in mammalian cellsDepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187951PurposeFKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 YFP
Plasmid#84911Purposeexpression of TDP-43 YFP in mammalian cellsDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2 Cryptic PE-Max
Plasmid#216163PurposeExpression of prime editor PEMax (Plasmid #174820) only in cells with TDP-43 loss of function. Note: It is not recommended to produce lentivirus containing TDP-REG sequences – see Depositor CommentsDepositorInsertPEMax for prime editing with internal cryptic exon
UseCRISPRExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase
Plasmid#196185PurposeCo-expresses MBP-GSK3β_S9A-HA-His (human GSK3β with S9A mutation as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β_S9A-HA-HisDepositorInsertsTagsGST, HA, His6, and MBPExpressionBacterialMutationchanged Serine 9 to AlaninePromoterTacAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA-NE
Plasmid#215486PurposeLentiviral expression of human alpha-synuclein in mammalian cellsDepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
IGF1R_pLX307
Plasmid#98344PurposeLentiviral expression of IGF1RDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLAG-PRMT3(E338Q)
Plasmid#164696PurposeExpression of PRMT3(E338Q) with an N-terminal FLAG tagDepositorAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
TGFB1_pLX307
Plasmid#98377PurposeLentiviral expression of TGFB1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 5F-L YFP
Plasmid#84914PurposeMammalian expresion of TDP-43 5F-L YFPDepositorInsertTDP-43 (TARDBP Human)
TagsYFPExpressionMammalianMutationF147L, F149L, F194L, F229L, F231LPromoterCMVAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-R-IscB-VR4-NLS (D60A, H243E, H269N, R270Q)_T2A_mCherry_U6-ωRNA
Plasmid#246431PurposeAll-in-one plasmid. Expresses R-IscB in mammalian cells. ssRNase enhancing mutations (H243E, H269N, R270Q) included.DepositorInsertsO.gue IscB-VR4 (H243E, H269N, R270Q) with RuvC dead mutations (D60A) and delta-TID
mCherry
ωRNA
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMV and U6Available SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-EcKlenow fusion - pCMV-T7-PCV2-EcKlenow (JO1421)
Plasmid#217804PurposeUnfused click editor construct expressing PCV2-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
FAS_pLX307
Plasmid#98334PurposeLentiviral expression of FASDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(Gaussia Luciferase)#5 in pTwist-CMV
Plasmid#216164PurposeExpression of secreted Gaussia Luciferase specifically in cells with TDP-43 loss of function. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertGaussia princeps luciferase (with double mutation to improve stability)
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only