We narrowed to 10,153 results for: tre promoter
-
Plasmid#157689Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp7 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pcDNA5-FRT-TO-Nsp15-HF
Plasmid#157722Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp15 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp2-HF
Plasmid#157684Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp2 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 4, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pECE M2-SH3PXD2A S974A
Plasmid#69814PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA[Sxl].1026B
Plasmid#112688Purposeexpress gRNA targeting Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3102
Plasmid#122548PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a plasma membrane localized gene (aqp-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT2999
Plasmid#122535PurposeExpression of a C. elegan codon optimized fluorescent protein (CemOrange2) fused to a lysosome localized gene (lmp-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmMextli
Plasmid#79262PurposeExpresses EGFP-tagged DmMextli in S2 cellsDepositorInsertDmMextli (mxt NM_164598, Fly)
UseSchneider 2 cell expressionTagsEGFPPromoterAc5 promoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTA-M+
Plasmid#249818PurposeExpresses Mycobacterium tuberculosis topoisomerase I under the control of the Tet promoter in mycobacteriaDepositorInsertMycobacterium tuberculosis topoisomerase I (topA Mycobacterium tuberculosis)
Tags6xHisExpressionBacterialPromoterTetAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-HaloTag-FRT
Plasmid#247338PurposeExpresses H2B-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
phSyn2 sfGFP-RNF152
Plasmid#215374PurposeLentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter.DepositorInsertRNF152 (RNF152 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only