We narrowed to 24,469 results for: CRISPR
-
Plasmid#192227Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRi
Plasmid#134989PurposedCas9-mediated inactivation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFS_0362_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._BA-91_ARRAY_1
Plasmid#116974PurposeExpresses CaBA-91RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. BA-91 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0356_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._SK-02_ARRAY_1_RC
Plasmid#116968PurposeExpresses CaSK-02RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. SK-02 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0355_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._SK-02_ARRAY_1
Plasmid#116967PurposeExpresses CaSK-02RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. SK-02 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73178-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiGuide-Puro (#73178). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiGuide-Puro plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Use on cells that are stably expressing Cas9 to make edits across 19,114 genes in the human genome.DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-CRISPRoffv2.1-IRES-BlastR
Plasmid#207180PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by EF1a PromoterDepositorInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT-P2A-Clover-BlastR
Plasmid#138568PurposeUniversal Cleavable Donor Plasmid for tagging with P2A-Clover-BlastR using NHEJDepositorInsertP2A-clover-BlastR
UseCRISPRAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB-TRE-CRISPRoff-EF1A-TetOn
Plasmid#203355PurposeDrug-inducible expression of CRISPRoff components needed for DNA methylation and gene repression with Sleeping Beauty backboneDepositorInsertCRISPRoff-TetOn
Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFVp-CRISPRoffv2.1-IRES-BlastR
Plasmid#207181PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by SFFV PromoterDepositorInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterSFFVpAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only