We narrowed to 11,618 results for: AGA
-
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFR093
Plasmid#134149PurposeExpression of CENP-TDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-4xUAS
Plasmid#125149PurposeVector to measure the activity of CP candidates in response to a tethered (4xUAS) GAL4-DBD-COF by determining the abundance of transcripts originating from each candidate in fly cellsDepositorInsert4 x upstream activating sequence (UAS)
UseStap-seq screening vectorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG_P-HXT1-FAS1up
Plasmid#126747Purposevector for replacing the promoter of FAS1 coding geneDepositorInsertfas1 upstream
Tags6xHisExpressionYeastPromoterHXT1Available SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-HXT1-FAS1up
Plasmid#126746Purposevector for replacing the promoter of FAS1 coding geneDepositorInsertfas1 upstream
Tags6xHisExpressionYeastPromoterHXT1Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Trf2
Plasmid#125159PurposeGateway entry cloneDepositorInsertTrf2 (Trf2 Fly)
UseGateway entry vectorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gamma2 UTR shRNA (shRNA4)
Plasmid#120796PurposeshRNA targeting the 3'-untranslated region (UTR) of the gamma2 mRNADepositorInsertGABRG2 shRNA (Gabrg2 Rat)
UseRNAiAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pGEX-4T1-MYB-TAD(251-327)
Plasmid#105619Purposebacterially express GST tagged MYB TADDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only