We narrowed to 41,361 results for: Eras
-
Plasmid#104470Purposeexpress His tagged P298L S329C hnRNPA2 LCDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pJC20cdc8.27
Plasmid#99362PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationGlutamic acid 129 to LysinePromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Fascin-Promoter (-210-0)
Plasmid#89826PurposeFascin promoter for luciferase assayDepositorAvailable SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
KC1G3_HUMAN_D0
Plasmid#79685PurposeThis plasmid encodes the kinase domain of KC1G3. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-192-Reporter
Plasmid#71872PurposeMammalian expression vector for the analysis of miR-19α activityDepositorInsertReverse complementary sequence of miR-192
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-193a-5p-Reporter
Plasmid#71873PurposeMammalian expression vector for the analysis of miR-193a-5p activityDepositorInsertReverse complementary sequence of miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-31-192-193a-Reporter
Plasmid#71874PurposeMammalian expression vector for the analysis of miR-31-19α-193a activityDepositorInsertBinding sequence targeted by miR-31, miR192, and miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARF4-no stop
Plasmid#67311PurposehArf4 without stop codon in Gateway Entry vectorDepositorInsertARF4 (ARF4 Human)
UseGateway entry vectorExpressionBacterialMutationV53A, L123P and M134I mutations were unintended P…Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-T]
Plasmid#60753PurposeContains PIq driving expression GalS-T, the Fucose inducible chimera with the TAN DBD.DepositorInsertsGalS-T
GalS-T
UseSynthetic BiologyExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES1L-dFN
Plasmid#51842PurposeFlag-CHES1L mutant lacking the forkhead binding site and N-terminal domainsDepositorAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES1L-DBD-NLS
Plasmid#51841PurposeFlag-CHES1L mutant encoding the DNA binding and NLS domains onlyDepositorInsertCHES1 (FOXN3 Human)
UseRetroviralTagsFlag and NLSMutationcontains CHES1 amino acids 110-205Available SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES1L-dC-NLS
Plasmid#51840PurposeFlag-CHES1L mutant lacking the C-terminal, with remaining NLSDepositorInsertCHES1 (FOXN3 Human)
UseRetroviralTagsFlag and NLSMutationcontains CHES1 amino acids 1-205Available SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES1LdFC-NLS
Plasmid#51838PurposeFlag-CHES1L mutant lacking the forkhead binding site and C-terminal domain, with remaining NLSDepositorInsertCHES1 (FOXN3 Human)
UseRetroviralTagsFlag and NLSMutationcontains CHES1 amino acids 1-109Available SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES11L-dFC
Plasmid#51837PurposeFlag-CHES1L mutant lacking the forkhead binding site and the C-terminal domainsDepositorAvailable SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
Hoxb6-3'UTR
Plasmid#31523DepositorAvailable SinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
MetClo DNA Assembly Kit
Plasmid Kit#1000000153PurposeMetClo DNA Assembly Kit allows modular, hierarchical assembly of DNA fragments using IIS restriction enzyme. Includes 3 E.coli strains for BsaI, BpiI and LguI-based MetClo assembly.DepositorAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHes1(2.5k)-luc
Plasmid#43806DepositorInsertHes1 Promoter (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoterPromoterHes1 PromoterAvailable SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-TA-ERP2-hcGAS(wt)
Plasmid#208396PurposeTo generate stable cell line expressing human cGAS(wt) using PiggyBac transposon systemDepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only