We narrowed to 25,779 results for: Nov;
-
Plasmid#83104PurposeLentiviral vector for constitutive expression of human mutant PC5A (R511C) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Arginine 511 to CysteineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (T288P)-V5 blast
Plasmid#83101PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (A270T)-V5 blast
Plasmid#83102PurposeLentiviral vector for constitutive expression of human mutant PC5A (A270T) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Alanine 270 to ThreonineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (H516P)-V5 blast
Plasmid#83103PurposeLentiviral vector for constitutive expression of human mutant PC5A (H516P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Histidine 516 to ProlineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Glu39Ala_P2A_Hygro_Barcode
Plasmid#120512PurposeBarcoded lentiviral vector to express MYC Glu39Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Glu39Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Glutamic Acid to Alanine …PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF8_P2A_Hygro_Barcode
Plasmid#120494PurposeBarcoded lentiviral vector to express KLF8 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M-L273D-L276D
Plasmid#114183PurposeORAI1 channel with C-terminal YFP, carrying the constitutively activating mutation V107M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP V107M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationV107M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M-L273D-L276D
Plasmid#114184PurposeORAI1 channel with C-terminal YFP, carrying the activating mutation T184M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP T184M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationT184M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-Sfxn1-3 (CG11739)
Plasmid#110642PurposeRetroviral expression of Flag-tagged Drosophila CG11739 in mammalian cellsDepositorInsertCG11739 (CG11739 Fly)
UseRetroviralTagsFLAGExpressionMammalianMutationcodon-optimized cDNA (no amino acid mutations)Available SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-INCENP d543-746
Plasmid#108473Purposeexpression of vsv-INCENP d543-746DepositorInsertINCENP d543-746 AA (INCENP Human)
TagsVSVExpressionMammalianMutationDelta Alpha helix, aa543-746 deletedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish aBb crystallin 5kb promoter/AcGFP
Plasmid#98101PurposeZebrafish aBb crystallin 5kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 5 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPPromoterDanio alpha Bb-crystallin 5 kb promoter fragment …Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish aBb crystallin 4kb promoter/AcGFP
Plasmid#98100PurposeZebrafish aBb crystallin 4kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 4 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPPromoterDanio alpha Bb-crystallin 4 kb promoter fragment …Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-SPA mimic WT
Plasmid#92350PurposeTo mimic SPA RNA processing and expressionDepositorInsertSNRPN exon 9, intron9, exon10, intron10 partial partial of SPA1 (SNRPN Human)
ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX302 PCSK5 (T288P)-V5 puro
Plasmid#98709PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDRf1-4CL5-AtSDT (JBEI-11535)
Plasmid#87934PurposeCo-expression in S.cerevisiae of 4CL5 and AtSDTDepositorAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
xCIAR_pcDNA5/FRT/TO
Plasmid#86504PurposeExpresses inactive control CIAR (xCIAR) in mammalian cells. Used to generate Flp-In stables.DepositorInsertxCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationF929A and T968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only