We narrowed to 15,447 results for: grn
-
Plasmid#162759PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9-HF1
Plasmid#126762PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-SpCas9-HF1 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than SpCas9HF1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-SpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; Q926A; amino acids 1005-1013…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPR_RAF1_94
Plasmid#111826PurposeKnockout Raf1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting RAF1 94-114 (RAF1 Human)
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEE495
Plasmid#149291PurposeT-DNA encoding TRV2 with direct repeat multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Direct_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-SGIPZ_NF1 sh1miR
Plasmid#119206Purposeknockdown of NF1DepositorAvailable sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmKikGR Actin
Plasmid#105315PurposePhotoconvertable cytoskeletal protein actin to study kinetics or dynamicsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertactin beta (ACTB Human)
TagsKikGRExpressionMammalianAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 E-cadherin shRNA/E-cadherin GFP-IRES-HA-H-Ras V12
Plasmid#101285PurposeLentiviral expression ,was generatedby recombining bothIRES an HA-tagged H-Ras V12 into SbfI site of pLL5.0 Ecadherin shRNA/mEcad-GFPDepositorInsertE-Cadherin-GFP-H-Ras
UseLentiviralTagsGFPExpressionMammalianMutationH-Ras V12Available sinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TNPO1-shRNA
Plasmid#86082PurposeA lentiviral construct for building stable cell lines expressing Transportin-1 shRNA via puromycin selection.DepositorAvailable sinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RorR-sh2 (Linc-sh2)
Plasmid#45765DepositorAvailable sinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-UL29-egfp-U3-UL8
Plasmid#166694PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (EGFP version).DepositorAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9/CD4-TK2
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTK2 (TK2 Human)
ExpressionMammalianPromoterU6Available sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-Esp3I-mU6-Kan
Plasmid#213015PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (H1 and mU6)DepositorInsertH1 promoter, mU6 promoter, gRNA scaffolds
PromoterH1 promoterAvailable sinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_NC_chr1
Plasmid#214690PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_TP73
Plasmid#214691PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWS3866
Plasmid#185743PurposeSub-array backbone 2/4DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_AAVS1
Plasmid#141212PurposepDECKO_mCherry_AAVS1_186. Targeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable sinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro
Plasmid#214680PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two empty sgRNA cloning sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSilencer-Opa1 KO
Plasmid#191949PurposeExpression of a siRNA that targets Opa1DepositorInsertOpa1
ExpressionMammalianAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by