We narrowed to 12,154 results for: NSI;
-
Plasmid#236192PurposeExpress GPR6 in insect cellsDepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-KGECO1-P2A-mGreenLantern
Plasmid#232843PurposeAAV transfer plasmid for CAG-mediated co-expression of KGECO1 and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-jRGECO1-P2A-mGreenLantern
Plasmid#232844PurposeAAV transfer plasmid for CAG-mediated co-expression of jRGECO1 and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(hBIRC2_1k)-PGKpuro2ABFP-W
Plasmid#208416PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_2b)-PGKpuro2ABFP-W
Plasmid#208417PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomajRGECO1a
Plasmid#232842PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted jRGECO1aDepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA378 - pBA904 Puro-T2A-GFP CD45 CRISPRa guide 3 (pRCA360 backbone)
Plasmid#238169PurposeLentiviral CRISPR guide vector expressing PTPRC targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD80-ST3-His
Plasmid#210665PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD80 fused to Spytag003 and Histag (CD80 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIRΔWIR
Plasmid#215508PurposeExpresses GFP tagged human ATG2A which has the mutation in LC3 interacting region and lacks WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-hSOX2-C17
Plasmid#206385PurposeExpresses human SOX2-C17 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only