We narrowed to 10,088 results for: crispr plasmids
-
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgT-REX17_EF1a-Puro-T2A-BFP
Plasmid#195501PurposeLentiviral BFP expression vector bearing a sgRNA targeting the promoter of human T-REX17DepositorInsertsgRNA
UseCRISPR and LentiviralTagsBFP, Puro, and T2AExpressionMammalianAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-TBG-Cre-sgArid1a
Plasmid#192165PurposeAAV-TBG-Cre-sgArid1aDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-TBG-Cre-sgKmt2d
Plasmid#192164PurposeAAV-TBG-Cre-sgKmt2dDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCamKII-Cre-pU6-SpCas9gRNAentry
Plasmid#210391PurposeAAV plasmid encoding the CamKII promoter driving Cre expression, along with SpCas9 gRNA entry cassette (RFP dropout)DepositorInsertAAV-(ITR)-pCamKII-NLS-Cre-WPRE-bGHpA-(rev)-SpCas9_gRNA-BsmBI_RFPcassette-hU6-(ITR) (NJA158)
UseAAV and CRISPRExpressionMammalianPromoterCamKII promoter for Cre, human U6 promoter for Sp…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis Bacterial Base Editor Activity
Plasmid Kit#1000000219PurposePlasmids for a base editing experiment to correct a mutation in the EGFP fluorescent reporter gene in Escherichia coli.DepositorApplicationFor the Classroom, Genome EditingVector TypeBacterial ExpressionEditing TypeCRISPRAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-mCherry
Plasmid#217005Purposelentiviral plasmid for gRNA cloning with selectable mCherry expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only