We narrowed to 13,831 results for: sequence
-
Plasmid#132980Purposeitga9 sgRNA targeting to "5'-TCCGCTGCCAGCCAGCCGG-3" in pDR274DepositorInsertitga9 sgRNA4 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA7
Plasmid#132981Purposeitga9 sgRNA targeting to "5'-CCCTCCAGCCTTCCATATG-3" in pDR274DepositorInsertitga9 sgRNA7 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:TBA2p
Plasmid#128429PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing the TBA2 (At1g62060) promoter sequence (1346 base pairs), for use in Three-way Gateway cloning.DepositorInsertTESTA ABUNDANT 2 (AT1G62060 Mustard Weed)
UseGateway promoter entry clonePromoterTESTA ABUNDANT 2Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q769gp160-QES.03
Plasmid#100930PurposeMammalian expression plasmid for Env from the Q769.d22 HIV-1 isolate; QES mutant with enhanced binding to antibody PG16DepositorInsertHIV-1 (Q769.d22) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations A200E;F…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaLgp160-QES.01
Plasmid#100921PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations T49D;P1…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaLgp160-QES.02
Plasmid#100923PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations T49D;P1…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-25711gp160-QES.c02
Plasmid#111842PurposeMammalian expression plasmid for Env from the 25711 HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (25711.2) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations I181L;V…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaLgp160-QES.i01.c01
Plasmid#111839PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations T49D;P1…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422gp160-QES.c03
Plasmid#111840PurposeMammalian expression plasmid for Env from the DU422 HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (DU422.1) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations V181L;V…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-pro-alphaf-Btl2
Plasmid#117665PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-pro-alphaf-Btl2
ExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pT2-cryR;dusp5CE1-P1Egfp
Plasmid#90151Purposecontains dusp5 enhancer sequence, and dusp5 specific gene promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dusp5CE1-basEgfp
Plasmid#90145Purposecontains dusp5 enhancer sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dll4CE2-basEgfp
Plasmid#90144Purposecontains dll4 enhancer 2 sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dll4CE1-basEgfp
Plasmid#90143Purposecontains dll4 enhancer 1 sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;lmo2CE1-basEgfp
Plasmid#90141Purposecontains lmo2 enhancer sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEdll4P1gfp
Plasmid#90125PurposeGateway Mid-entry clone containing promoter sequence specific for dll4 driving expression of eGFPDepositorAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pET151-hUCH37 (ISF1)(M148D/F149D)
Plasmid#71388PurposeExpression of hUCH37 (M148D/F149D) in E.coliDepositorInserthUCH37 (ISF1) M148D/F149D (UCHL5 Human)
TagsHIS-TEV sequenceExpressionBacterialMutationchanged methionine 148 to aspartate, phenylalanin…PromoterT7Available SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only