We narrowed to 11,382 results for: 158
-
Plasmid#173617PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smad4 (Smad4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTBL681 CHYRON4 integration construct
Plasmid#126449PurposeTo integrate the CHYRON4 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON4 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-Calpain
Plasmid#153295PurposeExpresses calpain-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertCalpain-sensitive Gas vesicle protein C (his-tagged)
TagsHis-tagExpressionBacterialMutation1) Contains an extra glycine after the methionine…PromoterT7Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLEX-rc [SomArchon-GFP]
Plasmid#153532PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSIK3-A
Plasmid#138682PurposeExpresses a mouse SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSIK3-C
Plasmid#138683PurposeExpresses a mouse SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL649 CHYRON2 integration construct
Plasmid#126446PurposeTo integrate the CHYRON2 locus at AAVS1 in human cells.DepositorInsertspU6-CHYRON2 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJC2297 - pHR-TRE3G-hSpCas9-NLS-FLAG-2A-Thy1.1
Plasmid#250251PurposeExpression of Cas9 with Thy1.1 cell surface marker under a doxycycline responsive promoter. Requires additional expression of transactivator.DepositorInserthSpCas9
UseCRISPR and LentiviralTagsNLS-FLAG-2A-Thy1.1PromoterTRE3GAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4804
Plasmid#249320PurposeExpresses Non-targeting sgRNA and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertnontargeting sgRNA
ExpressionBacterialMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5740
Plasmid#249327PurposeExpresses sgRNA targeting the fcy gene in S. cerevisiaeDepositorInsertsgRNA targeting fcy
ExpressionYeastMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-FAP-TGN38-GFP
Plasmid#242992PurposeInducible FAP-TGN38-GFP expression in mammalian cellsDepositorInsertdH6.2-TGN38-GFP (Tgoln2 Rat)
UseSleeping beautyTagsFAP and GFPExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-GFP-TGN38-FAP
Plasmid#242993PurposeInducible GFP-TGN38-FAP expression in mammalian cellsDepositorInsertGFP-TGN38-dH6.2 (Tgoln2 Rat)
UseSleeping beautyTagsFAP and GFPExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-mCer3-TGN38-FAP
Plasmid#242994PurposeInducible mCer3-TGN38-FAP expression in mammalian cellsDepositorInsertmCer3-TGN38-dH6.2 (Tgoln2 Rat)
UseSleeping beautyTagsFAP and mCer3ExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-trasHCknob6xHis
Plasmid#237364PurposepTwist CMV BetaGlobin encoding trastuzumab heavy chain with knob Fc and 6xHis tagDepositorInserttrastuzumab heavy chain
UseAffinity Reagent/ AntibodyTags6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-Sig9FcholeHA
Plasmid#237367PurposepTwist CMV BetaGlobin encoding Siglec-9-Fc with hole Fc and HA tagDepositorInsertSiglec-9-Fc (SIGLEC9 Human)
UseAffinity Reagent/ AntibodyTagsHAExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-Sig9R120AFcholeHA
Plasmid#237369PurposepTwist CMV BetaGlobin encoding Siglec-9-Fc R120A mutant with hole Fc and HA tagDepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-Sig10FcholeHA
Plasmid#237370PurposepTwist CMV BetaGlobin encoding Siglec-10-Fc with hole Fc and HA tagDepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only