We narrowed to 9,689 results for: Pol
-
Plasmid#251427PurposeMammalian expression vector for expressing HaloTag-fused mouse MYO7A truncated after the first MyTH4-FERM domainDepositorInsertMyosin VIIa (SH3 and M/F2 trancated) (Myo7a Mouse)
TagsHaloTagExpressionMammalianMutationThe SH3 and M/F2 domains trancatedAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHalo2X-mMYO7A-RK/AA
Plasmid#251426PurposeMammalian expression vector for expressing a HaloTag-fused mouse MYO7A mutant that destabilizes the autoinhibitory conformation.DepositorInsertMyosin VIIa (RK/AA) (Myo7a Mouse)
TagsHaloTagExpressionMammalianMutationTwo missense mutations in the RGSK motif of the s…Available SinceMarch 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
CD44v-EC-His (pcDNA3)
Plasmid#238418PurposeExpresses the polyhistidine-tagged extracellular region of CD44v (CD44v-EC-His)DepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-Cyclin B1 ND
Plasmid#234706Purposeallows tethering of non degradable (ND) cyclin B1 protein to lacO repeats in specific chromatin lociDepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC7 CD
Plasmid#224345PurposeExpresses human KDAC7 (HDAC7) catalytic domain in insect cellsDepositorInsertKDAC7 (HDAC7 Human)
TagsTEV-cleavable His6ExpressionInsectMutationOnly includes residues 521-942 (catalytic domain).PromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8ΔChromo
Plasmid#224708PurposeExpresses a human CBX8 truncation (deletion of the chromodomain) in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tagDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.mEGFP-CBX8
Plasmid#224710PurposeExpresses N-terminal hexahistidine-tagged human CBX8 in insect cells, with a monomeric variant EGFP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8
Plasmid#224707PurposeExpresses human CBX8 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mFzd4-opt(40-537)-9xHis_pFastBac1
Plasmid#216378PurposeBaculovirus transfer vector to express FLAG-tagged mouse Fzd4 (codon-optimized for insect cell expression)DepositorInsertFrizzled-4 (Fzd4 Mouse)
UseBaculovirusTagsHA signal sequence-FLAGExpressionInsectPromoterPolyhedrinAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-POWV_NS2B-GS-NS3
Plasmid#203471PurposeExpresses POWV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-LGTV_NS2B-GS-NS3
Plasmid#203468PurposeExpresses LGTV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-ZIKV_NS2B-GS-NS3
Plasmid#203477PurposeExpresses ZIKV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 2
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
Plasmid#60394PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) C130S, E446C for crosslinking polyglutamate peptideDepositorInsertTUB1 (TUB1 Synthetic, Budding Yeast)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
FNL Combinatorial Cloning Platform
Plasmid Kit#1000000211PurposeA Frederick National Laboratory (FNL) combinatorial cloning set to generate many tagged expression clones in parallel for protein production, in vivo gene expression, and shRNA and CRISPR delivery.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeBacterial Expression, Insect Expression, Mammalian ExpressionCloning TypeMultiSite GatewayAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC(elavl3)-CaMPARI2
Plasmid#137185Purposepan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)DepositorInsertHuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
UseTol2 plasmid for zebrafishTagsFLAG, HA, mycPromoterHuC(elavl3)Available SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only