We narrowed to 3,754 results for: crispr system
-
Plasmid#188500PurposeExpresses FLAG tagged HiFi dCas9 KRABDepositorInsertdCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A/R691A/H840APromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL0374 (His-MBP-Cas8_Cas7_Cas6)
Plasmid#130639PurposeExpresses V. cholerae CAST Cas8, Cas7, and Cas6 from a T7 promoter, with N-terminal His10-MBP-TEVsite tag on Cas8 for purification.DepositorInsertVchCas8, VchCas7, VchCas6
UseCRISPR; TransposonTagsHis10-MBP-TEVsite on Cas8ExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
OmEF1aCas9P2ApuroSB
Plasmid#165484PurposeStable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cellsDepositorInsertZebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
UseCRISPR; TransposonPromoterOreochromis mossambicus EF1 alpha promoter (OmEF1…Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
A3Bmax
Plasmid#207167PurposeExpress full-length human A3B in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLS and NLS, 6x HisExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
A3B-Cas9n-UGI-NLS
Plasmid#198889PurposeExpress full-length A3B BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL0373 (His-MBP-TniQ)
Plasmid#130638PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite tag for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEL666
Plasmid#196814PurposeLrCas9 genome editing plasmid in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0008
Plasmid#42248PurposegRNA targeted to zebrafish gene tia1lDepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSL0721 (pDonor_L1-105)
Plasmid#130645PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened left end. Total transposon size = 933 bp.DepositorInsertVchCAST donor DNA (short L)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0376 (His-MBP-StrepII-TniQ)
Plasmid#130641PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite-StrepII for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite-StrepII on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0715 (pDonor_R1-57)
Plasmid#130644PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened right end. Total transposon size = 910 bp.DepositorInsertVchCAST donor DNA (short R)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterLrk004PAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL669
Plasmid#196817PurposeLrCas9 genome editing plasmid in tomatoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterSlEF1aAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only