We narrowed to 43,939 results for: tro
-
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69887PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in DrosophilaDepositorExpressionInsectMutationF169L in ZKSCAN1PromoterMetallothionein Promoter (pMT)Available SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR5 Mm ATP10B
Plasmid#216391Purposetransfer plasmid for AAV vector production of mCherry and miR for Mm ATP10BDepositorInsertmcherry and miR Mm ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
Plasmid#216392Purposetransfer plasmid for AAV vector production of mCherry and miR for rat Rn ATP10BDepositorInsertmcherry and miR Rn ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-JFRC59-13XLexAop2-IVS-Syn21-Positron2-p10
Plasmid#239081PurposeLexA activated transgene expression of positive-going voltage sensor under the hsp70 promoter in D. melanogasterDepositorInsertPositron2
ExpressionInsectMutationR78K N81D D92N W178FPromoterhsp70Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-CasRx-pA
Plasmid#233038PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-CasRx-pA/EF1a-mCherry-WPRE-pa
Plasmid#233032PurposeTo Express HA tagged CasRX the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertCasRx and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724A
Plasmid#224741PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724A mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 to AlaninePromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724D
Plasmid#224742PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724D mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 Aspartate; Valine 53 Iso…PromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2088-Mut-GPA-NLuc-Biosensor-Retrovirus-TD138
Plasmid#222876PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). Mixed WT/V84R Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(V84R)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianMutationFRB chain: V84R in GPAPromoterMSCV LTRAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform E (codon optimized)
Plasmid#199570PurposeStable and dox. inducible expression of Trim69 isoform E (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform E (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform D (codon optimized)
Plasmid#199569PurposeStable and dox. inducible expression of Trim69 isoform D (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform D (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform C (codon optimized)
Plasmid#199568PurposeStable and dox. inducible expression of Trim69 isoform C (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform C (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Utrophin-GFP-U6ac-Rac2 guides
Plasmid#168254Purpose"label stable F-actin under Rac2 neutrophil-specific knockout background"DepositorInsertUtrophin-GFP
UseZebrafish expressionPromoterLyzCAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP209-Lenti-1.3CaMKII P-Intron-Flag-GluN2A-WPRE-pA
Plasmid#74714PurposepLenti vector backbone designed to express Flag-GluN2A from a 1.3CaMKII promoter. Transgene in reverse orientation.DepositorInsertFlag-GluN2A
UseLentiviralTagsFlagPromoter1.3CaMKIIaAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Utrophin-GFP-U6ac-ctrl guides
Plasmid#168253Purpose"label stable F-actin; control for neutrophil-specific knockout"DepositorInsertUtrophin-GFP
UseZebrafish expressionPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-sfGFP+HsbG syntron
Plasmid#172477PurposesfGFP with a synthetic intron derived from the human beta-globin geneDepositorInsertsfGFP
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-sfGFP+pCI syntron
Plasmid#172478PurposesfGFP with a synthetic intron from the pCI expression vector (Promega)DepositorInsertsfGFP
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only