We narrowed to 77,503 results for: son
-
Plasmid#49122PurposeAAV plasmid with FEV (Ple67) promoter driving expression of iCre. Contains WPRE.DepositorInsertssAAV-Ple67-iCre-WPRE
UseAAVExpressionMammalianPromoterFEVAvailable SinceMay 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab35 S22N inactive
Plasmid#47426DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFR (del3) L747-E749del, A750P
Plasmid#11015PurposeRetroviral construct for expressing human EGFR with L747-E749 deletion and A750P mutation in human cellsDepositorInsertEGFR (del3) (EGFR Human)
UseRetroviralExpressionMammalianMutationL747-E749 deleted, A750PAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pEMS1986
Plasmid#49117PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-iCre-WPRE
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCLXSN-c-JUN
Plasmid#102758PurposeExpression of c-JunDepositorAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-γ-tubulin
Plasmid#136799PurposeMammalian expression of the centrosomal protein _-tubulin N-terminally fused to SNAP-tagDepositorInsertSNAP-TUBG (TUBG1 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN-EphA2-Flag
Plasmid#102755PurposeExpression of EphA2DepositorAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1_RAF1 (51-131)
Plasmid#119218Purposepurification of GST-RAF1 RBD from E. coliDepositorInsertRAF1 aa 51-131 (RAF1 Human)
ExpressionBacterialAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-ALMS1
Plasmid#136828PurposeMammalian expression of the centrosomal protein ALMS1 N-terminally fused to SNAP-tagDepositorInsertSNAP-ALMS1 (ALMS1 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro2 T18N
Plasmid#47897PurposeExpresses myc tagged Miro2 T18N dominant negative mutantDepositorInsertMiro2 T18N (RHOT2 Human)
TagsmycExpressionMammalianMutationT18N, dominant negative mutantPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 WT KSR1
Plasmid#25970DepositorAvailable SinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro2 A13V
Plasmid#47896PurposeExpresses myc tagged Miro2 A13V constitutively active mutantDepositorInsertMiro2 A13V (RHOT2 Human)
TagsmycExpressionMammalianMutationA13V, constitutively active mutantPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pXJ42-p200 CUX1
Plasmid#100813PurposePlasmid vector expressing human p200 CUX1 (amino acids 1-1505 of P39880), with an N-terminal Myc tag and a C-terminal HA tagDepositorInsertp200 CUX1 (CUX1 Human)
UseNote that this plasmid does not have an sv40 oriTagsHA and MycExpressionMammalianAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP KNL1 wt hardened and RVSF->AAAA
Plasmid#45225DepositorInsertGFP KNL1 with RVSF-AAAA mutation, resistant to KNL1 siRNA (KNL1 Human)
MutationRVSF mutated to AAAAAvailable SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-Cep290
Plasmid#27380DepositorInsertCep290 (Cep290 Mouse)
TagsmCherryExpressionMammalianMutationplease see depositor comments belowAvailable SinceJune 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-mCep290
Plasmid#27379DepositorAvailable SinceFeb. 2, 2011AvailabilityAcademic Institutions and Nonprofits only