We narrowed to 18,351 results for: multi
-
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorPublicationInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Synthetic, Human)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal.Sth.dCas9
Plasmid#171088PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
DHFR-TSc3
UseToxoplasma gondii expressionMutationNote: A S245F mutation is present but did not app…PromoterDHFR-TS (Toxoplasma gondii) and U6 (Toxoplasma go…Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Neuregulin-HBD (Heparin binding domain, Type I/II) [N120A/9.1R]
Plasmid#114507PurposeMammalian Expression Plasmid of anti-Neuregulin-HBD (Heparin binding domain, Type I/II) (Human). Derived from hybridoma N120A/9.1.DepositorInsertanti-Neuregulin-HBD (Heparin binding domain, Type I/II) (Homo sapiens) recombinant mouse monoclonal antibody (NRG1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A)
Plasmid#55798PurposeIn addition to the mutations in alpha-s(alpha3beta5), this dominant negative G protein alpha-s mutant contains the G226A mutation, which impairs activating conformation changes in Switch II.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertalpha-s (alpha3beta5/G226A) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A in alpha…PromoterCMVAvailable sinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.1.529-AVI
Plasmid#181695PurposeExpresses SARS-CoV-2 S2P protein from the B.1.1.529 (Omicron) variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.1.529 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationA67V, ∆H69, ∆V70, T95I, G142D, ∆V143, ∆Y144, ∆Y14…Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight S174
Plasmid#53567PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-S174
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega1_KanR_BastaR
Plasmid#186426Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar)DepositorInsertsKanR
BastaR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP
Plasmid#171090PurposeCRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus thermophilus (CRISPR1 locus) in Toxoplasma gondii. Suitable for generating stable cell lines.DepositorInsertsSth1 dCas9
Chloramphenicol acetyltransferase
TagBFP
UseCRISPR; Toxoplasma gondii expressionTags3xFLAG, P2A peptide, SV40 NLS, T2A peptide, and n…MutationD9A, H599APromoterTUB1 (Toxoplasma gondii), transcriptionally linke…Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mTHC
Plasmid#112620Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsmTeal (mTFP1)ExpressionMammalianPromoterCAGAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
rEc.13
Bacterial strain#69494PurposeRecoded strain from MG1655 with prfADepositorBacterial resistanceAmpicillinAvailable sinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFGC-I2Cas9
Plasmid#173158PurposeExpresses Cas9 in dividing Arabidopsis cells. Contains dsRED and Basta for fast transformant selection.DepositorInsertshSpCas9
pNAP:dsRED:tNOS
pMAS:BAR:tMAS
ICU2 upstream regulatory region
Tags3xFLAG-NLS and NLSExpressionPlantMutationContains a D169N mutation with no visible effect …Available sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVHC
Plasmid#112614Purposepromoterless expression plasmid driving multicistronic cassette H2BVenus_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsVenusExpressionMammalianPromoterNo PromoterAvailable sinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB-NLS_T2A_EGFP (Y67X)_LNMA intron
Plasmid#246435PurposeExpresses inactive EGFP (Y67X) in mammalian cells for trans-splicing assessments. LMNA intron is inserted into EGFP CDS.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
EGFP
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMVAvailable sinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only