We narrowed to 1,585 results for: aav vector plasmid
-
Plasmid#130994PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6gRNA1-U6gRNA2-TnT-Cre
Plasmid#87682PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.DepositorInsertsgRNA1
gRNA2
Cre
UseAAVPromoterU6 and cTnTAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-Flag-PGC1a-6His
Plasmid#67637PurposeAAV vector expressing PGC1a geneDepositorAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYP1-miniSOG-T2A-mCherry
Plasmid#50972PurposeAAV2 transfer vector containing the InSynC (SYP1-miniSOG-T2A-mCherry) constructDepositorHas ServiceAAV8InsertSynaptophysin-miniSOG-T2A-mCherry (Syp Rat)
UseAAVTagsT2A-mCherry and miniSOGPromoterhuman synapsin promoterAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-WPRE
Plasmid#130988PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-WPRE
Plasmid#130990PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-WPRE
Plasmid#130992PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PdTK-CAG-mCh-[uBglII]
Plasmid#107280Purposepuro-deltaTK gene-trap selection cassette (AAVS1 donor vector backbone) with constitutive mCherryDepositorInsertAAVS1 puro-deltaTK; CAG-mCherry (PPP1R12C )
Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV Syn-FLEX-coca-5HT3-IRES-mCherry
Plasmid#242195PurposeCre-dependent AAV vector for cocaine-gated chemogenetic cation channelDepositorInsertSyn-FLEX-coca-5HT3-IRES-mCherry (Htr3a Mouse)
UseAAVExpressionMammalianMutationL141G G175K Y210F Y217FPromoterSynapsinAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{hM4Di-mCherry}on-W3SL
Plasmid#111397PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON hM4Di-mCherry (Gi-coupled DREADD for neuronal silencing), W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsMyc and mCherryExpressionMammalianPromoterhSynapsinAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
Plasmid#227800PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#50942PurposeBicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-hTau-T2A-EGFP-WPRE3-BGHpA
Plasmid#240284PurposeThe plasmid will package wild-type human Tau (hMAPT) as a T2A fusion with EGFP from a CMV promoterDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-fDIO-GFP-IRES-tTA
Plasmid#118026PurposeAAV vector for sparse and bright labeling in a cell-type specific mannerDepositorInsertTRE-fDIO-GFP-IRES-tTA
UseAAVMutationSee depositor comments belowPromoterTREAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only