We narrowed to 1,718 results for: cag promoter
-
Plasmid#184614PurposeFor expression of a fluorescent sensor for neurotensin in mammalian cellsDepositorInsertMTRIA-NTS
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NMB
Plasmid#184610PurposeFor expression of a fluorescent sensor for neuromedin B in mammalian cellsDepositorInsertMTRIA-NMB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIE043 ZF43x1 mKate2 (TUPV1)
Plasmid#138723PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCSDepositorInsertZF43x1
UseSynthetic BiologyExpressionMammalianPromoterZF43x1Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE042 ZF43x0 mKate2 (TUPV1)
Plasmid#138722PurposemMoClo TUPV, with ZF43x0 promoter and mKate2 in the MCSDepositorInsertZF43x0
UseSynthetic BiologyExpressionMammalianPromoterZF43x0Available SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA3
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA2
Plasmid#160211PurposeKnock Down MTLSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA2 targeting collybistin MTL-CBSH3-isoforms (Plasmid #160210)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGACGTTGCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_TRE3VG_EGFP-Responder
Plasmid#230050PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertTRE3VG_EGFP
ExpressionMammalianPromoterGAAGACAATAGCAGGCATGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_mEmerald_I3
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pstb-LAFR5
Plasmid#86169PurposepLAFR5 with Smb21651 promoter. pLAFR5 is a broad-host range cosmid vector with double cos sites.DepositorTypeEmpty backboneExpressionBacterialPromoterSMb21651 promoterAvailable SinceFeb. 6, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV:AsCpf1-2A-GFP-U6-GFP-sg
Plasmid#194717PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target GFPDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p304N
Plasmid#246317PurposePlant CRISPR editing with the experimentally validated Medicago truncatula MtU6.6 promoter (352 bp)DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
PromoterJ23119 and TetAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCLYBL-Neo_TRE3VG_mCherry_Responder
Plasmid#230054PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expressionDepositorInsertTRE3VG_mCherry
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only