We narrowed to 19,406 results for: Tat
-
Plasmid#242710Purposehuman CHAC1 gene expressionDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationMultiple wobble mutationsPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
BTRC-HaloTag Vector
Plasmid#238660PurposeExpress BTRC-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertBTRC (BTRC Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
M8
Plasmid#180253PurposeVaccine vector encoding 8 neonatigens specific for the MC38 colon cancer mouse modelDepositorInsertSynthetic gene encoding for 8 neonatigens specific for MC38 mouse cancer cells
UseVaccine vectorExpressionMammalianMutationthe polyepitope vaccine encodes for mutated seque…PromoterCMVAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA905 - KLF4 Puro-T2A-BFP (pRCA847 backbone)
Plasmid#238185PurposeLentiviral vector for overexpression KLF4 ORF from a EF1a promoterDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA881 - KLF4 Puro-T2A-GFP (pRCA847 backbone)
Plasmid#238182PurposeLentiviral vector for overexpression KLF4 ORF from a EF1a promoterDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4080
Plasmid#215249PurposeModule for the constitutive expression of EGFP, p19 and the N. nambi luminescence pathway genes fused to a SF.DepositorInsertSF-EGFP-p19-LUZ-H3H-HISPS-CPH
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PHB2 S39D-mCherry
Plasmid#232787PurposeEncodes an mCherry-tagged Prohibitin2/PHB2 constitutively phosphorylated on Ser39DepositorInsertPHB2 (PHB2 Human)
TagsmCherryExpressionMammalianMutationChanged Serine 39 to AspartatePromoterCMVAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB9P2
Plasmid#210030PurposeContains PE2 prime editing gRNA cloning site, inducible prime editor 2, rtTA-T2A-puroDepositorInsertsprime editor 2
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-FoxP3-R337Q/A372S-IRES-Thy1.1
Plasmid#229619PurposeMammalian expression of full length mouse FoxP3 (R337Q, A372S)DepositorInsertfull length FoxP3, carrying double mutation R337Q/A372S (Foxp3 Mouse)
ExpressionMammalianMutationR337Q/A372SAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHW100002
Plasmid#222440PurposeLevel 0, CDS module (AATG-GCTT) containing rice OsL5.DepositorInsertOsL5 (Oryza sativa)
UseSynthetic BiologyExpressionPlantMutationBsaI/BbsI sites removed by point-mutationAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4542
Plasmid#215261PurposeModule for the expression of the N. nambi HISPS gene under the regulation of the copper inducible CBS4x:mDFR promoter and TNOS and the constitutve expression of CPH, LUZ, H3H, EGFP and p19DepositorInsertCBS4x:mDFR:HISPS-SF-CPH-SF-LUZ-H3H-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP574
Plasmid#222953PurposeExpresses R120A LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 120 to AlaninePromoterT7Available SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat DJ-1 shRNA
Plasmid#222870PurposeExpresses mTagBFP2 along with an shRNA against rat DJ-1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-UBC_NKX2-1
Plasmid#221495PurposeNKX2-1 short isoform lentiviral overexpression using UBC promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1
Plasmid#221494PurposeNKX2-1 short isoform lentiviral overexpression using hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4401
Plasmid#215252PurposeModule for the expression of the N. nambi HISPS gene under the regulation of PNOS and TNOS and the constitutive expression of CPH, LUZ, H3H, EGFP and p19.DepositorInsertSF-PNOS:HISPS:TNOS-CPH-LUZ-H3H-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS4
Plasmid#218713PurposeExpresses N-terminally EGFP-tagged BBS4 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPbHiT_3xmyc_hsp70UTR_hdhfr/yfcu
Plasmid#216421PurposeEmpty backbone to express gene specific gRNA and carry the homology repair template for CRISPR editing of Plasmodium berghei using the PbHiT system.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiTags3xmycExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only