We narrowed to 16,111 results for: grna
-
Plasmid#115487PurposeCRISPR Cas9 SunTag system to target NtDRMcd to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133D
Plasmid#69289PurposeGolden Gate entry vector; 1st gRNA under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ146-ZmUbi-tRNA
Plasmid#158404PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ136-tRNA2.0; assembly of 6 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX335-EN477
Plasmid#86232PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse CTCF locus. Use together with pX335-EN475.DepositorInsertspCas9-nickase and sgRNA against mouse CTCF STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330 Ctnnb1.2
Plasmid#59912PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH1v1
Plasmid#60244PurposegRNA expression by the H1 promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 promoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo sgTREX1
Plasmid#127645PurposeKnock-out of human TREX1 with NeoRDepositorInsertTREX1 sgRNA (TREX1 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133A2.0
Plasmid#99891PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
TUNEYALI Kit
Plasmid kit#1000000255PurposeRegulate gene expression by combining gRNA constructs targeting natural promoters and insertion of synthetic promoters in Yarrowia lipolytica.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector typeYeast ExpressionEditing typeCRISPRCloning typeGolden GateAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426*-SpSgH
Plasmid#136993PurposeHelper plasmid for SpCas9 gRNA cloning and expressionDepositorTypeEmpty backboneExpressionYeastPromoterSNR52Available sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRU325
Plasmid#167676PurposeIntermediate vector for eight gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC593
Plasmid#62319PurposesgRNA with MS2-PP7 for yeast cellsDepositorInsertsgRNA + MS2-PP7 RNA binding module
ExpressionYeastPromoterSNR52Available sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ143-ZmUbi-tRNA
Plasmid#158400PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ133-tRNA2.0; assembly of 3 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only