We narrowed to 13,472 results for: sequence
-
Plasmid#113952Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S and S212N su…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N-D231G
Plasmid#113953Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S, S212N, and …PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C entry vector
Plasmid#111752PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with C-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINTBxb1
Plasmid#127536PurposePlasmid encodes A. thaliana codon optimized Integrase Bxb1.DepositorInsertIntegrase Bxb1 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Flrt3-AP-His
Plasmid#71949PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhAC T2A tDimer
Plasmid#101722Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neuronsDepositorInsertsCatRhAC
red fluorescent protein
UseAAVMutationE497K,C569DPromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 C64Y
Plasmid#139326PurposePlasmid expressing a sgRNA to introduce BRCA1 C64Y using base editingDepositorInsertsgRNA to insert BRCA1 C64Y using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 FS10
Plasmid#113956Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, S212N substitution…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES
Plasmid#182485PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TMED3-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170996PurposeHiLITR transcription factor with full-length TMED3 targeting sequence (ER/Golgi)DepositorInsertTMED3(FL)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (TMED3 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-PHLDA3(wt)
Plasmid#72557PurposeHypoxia induced mutant PHLDA3. Contains the HRE from VEGF sequence (5 repeats) upstream of PHLDA3.DepositorAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-V1251R_R
Plasmid#147376PurposeMammalian Expression of HsNot1iso1-V1251RDepositorInsertHsNot1iso1-V1251R (CNOT1 Human)
ExpressionMammalianMutationA deletion of 5 AA 822-827 SKMKPS-> T and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight Q175
Plasmid#53566PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-Q175
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only