178,552 results
-
Plasmid#104398Purposepolycistronic vector for expression of E. coli core RNAPDepositorTagsHis6ExpressionBacterialPromoterT7Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EB3-mScarlet-I
Plasmid#98826PurposeIn vivo visualization of microtuble plus ends (can be used for colocalization studies)DepositorInsertEB3
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJL 89
Plasmid#98558PurposeUseful for making infectious clones of RNA virus cDNAs; Has 35S promoter and HDV Ribozyme sequences in T-DNA region of Agrobacterium vector.DepositorTypeEmpty backboneExpressionPlantPromoterEnh 35SAvailable sinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL-FcHis
Plasmid#99846Purposemammalian expression with secretive signal and FC tagDepositorAvailable sinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DNA-PKcs ABCDE>A
Plasmid#83318Purposehuman DNA-PKcs/ABCDE>alaDepositorInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutation6 phosphorylation sites in the ABCDE cluster subs…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-TrxRFP1
Plasmid#98996Purposemammalian expression of a biosensor to monitor thioredoxin redox dynamicsDepositorInserthuman thioredoxin 1, GS-rich linker, fused with a redox-sensitive RFP
TagsHis-tagExpressionMammalianPromoterCMVAvailable sinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C0000
Plasmid#91081PurposeModule C, Promoter: none, Gene: none (BaeI site for GT donor cloning), Terminator: noneDepositorTypeEmpty backboneUseUnspecifiedAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7TFP CDH1 reporter
Plasmid#91704Purposelentiviral luciferase reporter containing CDH1 promoterDepositorInsertCDH1 promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianPromoterCDH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CD8a
Plasmid#86050PurposeA mammalian expression plasmid encoding CD8a without tag.DepositorAvailable sinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_HSP90B1_WT
Plasmid#82130PurposeGateway Donor vector containing HSP90B1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-HaloTag-KanMX6
Plasmid#87029PurposeTag S. pombe genes in C terminal with HaloTagDepositorInsertHaloTag
ExpressionBacterial and YeastAvailable sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available sinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY095
Plasmid#84744PurposeExpresses huLbCpf1-T2A-GFP and crRNA guideDepositorInsertshuLbCpf1
GFP
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pP{ELAV-GeneSwitch}
Plasmid#83957PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotorDepositorInsertExpressionInsectPromoterelavAvailable sinceDec. 10, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2 Gateway compatible toolbox for the study of the nervous system and neurodegenerative disease
Plasmid kit#1000000087PurposeA plasmid collection, based on the Tol2kit, used to streamline the production of transgenic zebrafish for studying neurodegenerative disorders.DepositorApplicationCloning and Synthetic BiologyVector typeZebrafish ExpressionCloning typeMultiSite GatewayAvailable sinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-loxP-mTagBFP2-stop-pA-loxP
Plasmid#75158PurposeFloxed TagBFP2 (blue) fluorophore with stop codon for inducible lines.DepositorPublicationInsertloxP-mTagBFP2-stop-pA-loxP
UseMiddle entry vector for multisite gateway three f…Promotern/aAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_Zika_NS4B_Flag
Plasmid#79640PurposeThird generation Self-inactivating lentivector expressing NS4B from Zika virusDepositorInsertNS4B
UseLentiviralTagsFlagExpressionMammalianPromoterEF1Available sinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCCL-c-MNDU3-X
Plasmid#81071PurposeEmpty lentiviral backbone with the MNDU3 promoterDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterMNDU3Available sinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by