We narrowed to 5,551 results for: crispr cas9 grna plasmid

#166105

This plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination

Matthias Heinemann

April 13, 2021

Academic Institutions and Nonprofits only

#179916

All in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.

Indeever Madireddy, Johan Sosa

Madireddy et al MicroPubl Biol. 2022 Jun 16;2022. doi: 1

April 4, 2022

Academic Institutions and Nonprofits only

#179915

All in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.

Indeever Madireddy, Johan Sosa

Madireddy et al MicroPubl Biol. 2022 Jun 16;2022. doi: 1

April 4, 2022

Academic Institutions and Nonprofits only

#179917

All in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.

Indeever Madireddy, Johan Sosa

Madireddy et al MicroPubl Biol. 2022 Jun 16;2022. doi: 1

April 4, 2022

Academic Institutions and Nonprofits only

#179914

All in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.

Indeever Madireddy, Johan Sosa

Madireddy et al MicroPubl Biol. 2022 Jun 16;2022. doi: 1

April 4, 2022

Academic Institutions and Nonprofits only

#204291

For inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.

David Stern

Stern et al bioRxiv 2023.06.17.545412

Sept. 5, 2023

Academic Institutions and Nonprofits only

#60958

pAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.

Feng Zhang

Swiech et al Nat Biotechnol. 2014 Oct 19. doi: 10.103

Nov. 17, 2014

Academic Institutions and Nonprofits only

#241309

Lentiviral SpCas9-gRNA (ZNF865) expression vector with DsRed-Express2-P2A-BlastR

Robby Bowles

Dec. 8, 2025

Academic Institutions and Nonprofits only

#113972

Single short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#113973

Single short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only