We narrowed to 15,169 results for: GRN
-
-
-
OA-1053A
Plasmid#184006PurposeExpresses arrays of gRNA targeting eve promoter under U6b/c promoterDepositorInsertU6b:sgRNAeve1 - U6c:sgRNAeve2
ExpressionInsectAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX-APRT-sg2
Plasmid#107274PurposeAPRT sgRNA-2 and Cas9 expression vectorDepositorInsertAPRT sgRNA-2
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA098
Plasmid#245320PurposeCas9 CRISPRko all-in-one positive control; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA102
Plasmid#245324PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_SpCas9
Plasmid#107328PurposeU6 driven SpCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_NmCas9
Plasmid#107329PurposeU6 driven NmCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT59
Plasmid#223431PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-2
Plasmid#210130Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-1
Plasmid#210013Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-CDS
Plasmid#136040PurposeUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH85
Plasmid#128198Purposeclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH86
Plasmid#128199Purposeimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN1
Plasmid#125771Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN1 (WRN Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN2
Plasmid#125772Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN2 (WRN Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only
