We narrowed to 1,121 results for: gibson assembly
-
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_15bpLinker
Plasmid#157786PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 15 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_15bp linker
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWM_12x601_30bpLinker
Plasmid#157789PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 30 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_30bp linker
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SspBmicro-mCh-p60
Plasmid#190168PurposeExpresses SspBmicro-mCh-p60, a recruitable katanin for microtubule severing, in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSspBmicro-mCherry-p60
TagsSspBmicro-mCherryExpressionMammalianAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SpySwitch
Plasmid#184225PurposeExpresses SpySwitch in the bacterial cytoplasm. SpySwitch binds SpyTag-, SpyTag002- or SpyTag003-fusions non-covalently for affinity purification, allowing gentle pH or temperature release.DepositorInsertSpySwitch
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWM_12x601_45bpLinker
Plasmid#157791PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 45 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_45bp linker
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
EB3N-VVDfast-mCl3-iLID
Plasmid#190165PurposeExpresses EB3N-VVDfast-mCl3-iLID, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEB3N-VVDfast-mClover3-iLID (MAPRE3 Human, Synthetic)
Tags-VVDfast-mClover3-iLIDExpressionMammalianMutation1-189 aa from EB3Available sinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable sinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG79-attL1-pegRNA-attL2
Plasmid#213050PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_20bpLinker
Plasmid#157787PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 20 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_20bp linker
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWM_12x601_35bpLinker
Plasmid#157790PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 35 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_35bp linker
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Halo-Rab6A
Plasmid#190171PurposeExpresses HaloTag-Rab6A in mammalian cells.DepositorAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AdenoBuilder toolkit
Plasmid kit#1000000176PurposePlasmids containing modular inserts that span the human adenovirus serotype 5 (HAdV5) genome that can be assembled in a one-tube reaction.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector typeAdenoviral, Mammalian ExpressionCloning typeGibsonAvailable sinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EB3N-VVDfast-Halo-iLID
Plasmid#190166PurposeExpresses EB3N-VVDfast-Halo-iLID, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEB3N-VVDfast-Halo-iLID (MAPRE3 Human, Synthetic)
Tags-VVDfast-mClover3-iLIDExpressionMammalianMutation1-189 aa from EB3Available sinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_193 NRL + TetO
Plasmid#157812PurposeEcoRV digestion produces 12x601 chromatin assembly construct with central TetO in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_tetO
ExpressionBacterialAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
p12x601
Plasmid#157785PurposeEcoRV digestion produces 12x601 chromatin assembly construct with central TetO following PEG removal of plasmid backboneDepositorInsertpMD2.G(spei/spei)&12x601_tetO
ExpressionBacterialAvailable sinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD(Gib)_3'omega
Plasmid#223870Purpose4G-cloning donor for 3'-Gibson overhang, omega-sequenceDepositorInsert3'omega sequence and spacer
UseGolden-gate donorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD(Gib)_5'alpha
Plasmid#223863Purpose4G-cloning donor for 5'-Gibson overhang, alpha-sequenceDepositorInsert5'alpha sequence and spacer
UseGolden-gate donorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD(Gib)_5'gamma
Plasmid#223865Purpose4G-cloning donor for 5'-Gibson overhang, gamma-sequenceDepositorInsert5'gamma sequence and spacer
UseGolden-gate donorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD(Gib)_5'beta
Plasmid#223864Purpose4G-cloning donor for 5'-Gibson overhang, beta-sequenceDepositorInsert5'beta sequence and spacer
UseGolden-gate donorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only