We narrowed to 11,079 results for: cat.1
-
Plasmid#89499PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
NSE-huCof K22Q + rat cof shRNA
Plasmid#245962PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of K22Q mutant of human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterNSE for cofilin K22Q and pol III for shRNAAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof null + rat cof shRNA
Plasmid#245960PurposeSilencing of endogenous cofilin in rat/mouse cells with replacement by an inactive human cofilin expressed with a cofilin promoter (control for plasmid listed above)DepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutation_1-5, Y82F, KK95,96QQPromoterMCP for cofilin and pol III for shRNAAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pISL1.1.0-gDNA
Plasmid#113788PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ISL1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His-mTET1CD
Plasmid#81053Purposebacterial expression of the catalytic domain of murine TET1DepositorInsertTET1 (Tet1 Mouse)
Tags6HISExpressionBacterialMutationcatalytic domain amino acid 1367-2057PromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-OGT_opt
Plasmid#190858PurposeFor mammalian expression of wild-type full-length human ncOGT. The ncOGT is not epitope-tagged, but is codon-optimized for human cells.DepositorInsertO-GlcNAc Transferase (OGT Human)
ExpressionMammalianMutationCodon optimized for expression in human cells.PromoterCMVAvailable SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKI_ΩBBMVP16&WUS
Plasmid#220348PurposeExpresses BBM-VP16 and WUS in plant cellsDepositorTagsVP16 transcriptional activation domainExpressionPlantPromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.Y591X) 3x FLAG
Plasmid#74261PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.Y591X truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.R404X) 3x FLAG
Plasmid#74263PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.R404X truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail
Plasmid#60392PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) using a GAL promoterDepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 DomI + DomII pMT2
Plasmid#206095Purposeexpression of the N-terminus, Domain I, Domain II and the II-III loop (amino acids 1-1154) of rabbit Cav2.2 calcium channel with a N-terminal GFP tagDepositorAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PRKAA1
Plasmid#20595DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-h-cGASCD(K427E/K428E)
Plasmid#127162Purposeexpression of truncated human cGAS proteinDepositorAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTR-341 pUC19-tNGFR-P2A-PDCD1 N
Plasmid#186074PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF7B C-trunc_nostop
Plasmid#153956PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 11, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 ORF7B C-trunc
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
hGli3 NTOTAL in AINGpCAGGS
Plasmid#121973Purposemedium Gli3 transcriptional repressorDepositorInserthGli3 NTOTAL (GLI3 Human)
UseChick electroporationTags5xmyc and Linker A IRES NLS GFP pCAGGSExpressionMammalianMutationC terminus deletion from zinc finger domainAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only