We narrowed to 10,528 results for: UTY
-
Plasmid#158285PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.C.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.HA.C_NGFR
Plasmid#158257PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.HA.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.NWS.C_NGFR
Plasmid#158258PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.NWS.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.C_NGFR
Plasmid#158261PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.ARID3A-3'UTR-WT
Plasmid#169297PurposeConstitutive overexpression of the 3'UTR of the human ARID3A gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-EF1α-Luc-C20orf24-3’UTR-VAR
Plasmid#128507PurposeLentiviral constitutive expression of Firefly luciferase under control of 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ218a QTY
Plasmid#162444PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
Tagshis-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b QTY
Plasmid#162445PurposeExpression in E coli and perform ligand binding in solutionDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
Tagshis-tagExpressionBacterialMutationAll L, I, V, F in the transmembrane region mutate…AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Hygro DHFR.dn-cHSF1
Plasmid#134731PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.3
Plasmid#206137PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-hCCND1-HA
Plasmid#174154PurposeLentiviral vector expressing HA-tagged human cyclin D1DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagshemagglutinin (HA)ExpressionMammalianPromoterEF1AAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only