We narrowed to 10,399 results for: ADA
-
Plasmid#213037PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.16 with with furin side intactDepositorInserts -RRAR.XBB.1.16 (S )
TagsHRV 3C cleavage site (before tags) 8X His tag 2X…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 furin site RRAR …PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR-OMICRON.BA.5
Plasmid#213071PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.5 with with furin side intactDepositorInsertpαH-S-RRAR-OMICRON.BA.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685, furin site inta…Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZucchini2_SFFV-RXRA-eGFP-IRES-mCherry_PuroR
Plasmid#247929PurposeOverexpression vector for eGFP tagged RXRA or NR2B1. Monitor post-translational degradation of RXRA via EGFP:mCherry ratio. Contains puromycin-resistance selection marker.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSquash2_SFFV-eGFP-NR3C1-IRES-mCherry_PuroR
Plasmid#247928PurposeOverexpression vector for eGFP tagged GR or NR3C1. Monitor post-translational degradation of GR via EGFP:mCherry ratio. Contains puromycin-resistance selection marker.DepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/EG.5.1
Plasmid#218668PurposeMammalian cell expression of SARS-CoV-2 Spike protein of OMICRON.EG.5.1 variantDepositorInsertpαH-S-GSAS/EG.5.1 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/XBB.1.16
Plasmid#212992PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.16DepositorInsertpαH-S-GSAS/XBB.1.16 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q, E180…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/EG.5
Plasmid#212990PurposeMammalian cell expression of SARS-CoV-2 Spike protein of OMICRON.EG5 variantDepositorInsertpαH-S-GSAS/EG.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Perturb-seq GBC library
Pooled Library#85968PurposeBarcode library for cloning gRNA sublibraries for single cell CRISPR analysis.DepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.20m-eVRQR-P2A-EGFP (LLH569)
Plasmid#242656PurposeCMV promoter expression plasmid for human codon optimized ABE8.20 A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.20m-VRQR-S55R-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA, eVRQR mutations in SpC…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8e-eVRQR-P2A-EGFP (HES1425)
Plasmid#242657PurposeCMV promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8e-SpCas9-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA, eVRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-term AAV-ABE8e-SpCas9(S55R) (CA21)
Plasmid#242659PurposeCBh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-SpCas9(S55R) - to be used with eVRQR constructsDepositorInsertpAAV-pCBh-BPNLS(SV40)-TadA8e-gs-SpCas9(D10A;S55R)-[N-term]-NpuN-BPNLS(SV40)-WPRE-bGH_PA
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationSpCas9(S55R)PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-SpG-P2A-EGFP (BKS965)
Plasmid#242652PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpG(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpG-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, SpG mutations in SpCas9…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON
Plasmid#180423PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSASDepositorInsertSpike (S-GSAS-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/XBB.1.5
Plasmid#212993PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 with with furin side intactDepositorInsertSpike S-RRAR/XBB.1.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); furin site intake; (T19I…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSquash2_SFFV-eGFP-NR3C1-IRES-mCherry_NeomycinR
Plasmid#247927PurposeOverexpression vector for eGFP tagged GR or NR3C1. Monitor post-translational degradation of GR via EGFP:mCherry ratio. Contains neomycin-resistance selection marker.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZucchini2_SFFV-RARA-eGFP-IRES-mCherry_NeomycinR
Plasmid#247925PurposeOverexpression vector for eGFP tagged RARA or NR1B1. Monitor post-translational degradation of RARA via EGFP:mCherry ratio. Contains neomycin-resistance selection marker.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZucchini2_SFFV-RARA-eGFP-IRES-mCherry_PuroR
Plasmid#247926PurposeOverexpression vector for eGFP tagged RARA or NR1B1. Monitor post-translational degradation of RARA via EGFP:mCherry ratio. Contains puromycin-resistance selection marker.DepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only