We narrowed to 15,447 results for: grn
-
Plasmid#86329PurposeEncodes gRNA for 3' target of human MLXDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against MLX (MLX Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_DMAP1_2
Plasmid#86355PurposeEncodes gRNA for 3' target of human DMAP1DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against DMAP1 (DMAP1 Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_DMAP1_1
Plasmid#86354PurposeEncodes gRNA for 3' target of human DMAP1DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against DMAP1 (DMAP1 Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIL3_2
Plasmid#86349PurposeEncodes gRNA for 3' target of human NFIL3DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against NFIL3 (NFIL3 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIL3_1
Plasmid#86348PurposeEncodes gRNA for 3' target of human NFIL3DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against NFIL3 (NFIL3 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MLX_2
Plasmid#86330PurposeEncodes gRNA for 3' target of human MLXDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against MLX (MLX Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF644_2
Plasmid#86306PurposeEncodes gRNA for 3' target of human ZNF644DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZNF644 (ZNF644 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF644_1
Plasmid#86305PurposeEncodes gRNA for 3' target of human ZNF644DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZNF644 (ZNF644 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro-PJY390
Plasmid#251159PurposeCloning backbone for guide RNAs compatible with 10x FLEXDepositorInsertSpCas9 sgRNA F+E
UseCRISPR and LentiviralPromoterEF1aAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX330_H1.0
Plasmid#247482PurposeExpresses SpCas9 and a sgRNA targeting the human histone H1.0 loci for knock-in.DepositorAvailable sinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg2
Plasmid#244870PurposeKnockout of human SLC31A1DepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg1
Plasmid#244869PurposeKnockout of human SLC31A1DepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGK61
Plasmid#228121PurposeExpress node 1467 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1467, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3346 PB-nicking guide-blast
Plasmid#226665PurposePiggyBac cargo vector encoding protective nicking sgRNA marked with blasticidinDepositorInsertprotective nicking sgRNA
UseCRISPRExpressionMammalianPromoterhU6Available sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_220
Plasmid#164560PurposeLentiviral vector that encodes two sgRNA expression cassettes (one constitutive, one inducible via Flp). Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsFirst sgRNA cassette
Second sgRNA cassette
UseCRISPR and Lentiviral; Flp/frtExpressionMammalianPromoterHuman U6 and Mouse U6Available sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6::sgBFP-U6::sgKrasG12D-pX333-red
Plasmid#149448PurposepX333 backbone expressing 2 sgRNA targeting BFP and KRAS G12D to edit mouse KRAS G12D allele.DepositorInsertsgRNA BFP and mouse KRAS G12D
UseCRISPRExpressionMammalianAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-sgArid1b#2/Cre
Plasmid#173574PurposeExpresses a Arid1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1b (Arid1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only