We narrowed to 12,298 results for: shRNA
-
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-1-3'
Plasmid#117324PurposeCRISPR-Cas9 for miR-124-1, 3'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-3-5'
Plasmid#117323PurposeCRISPR-Cas9 for miR-124-3, 5'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#1
Plasmid#106345Purposesmall guide RNA #1 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#2
Plasmid#106346Purposesmall guide RNA #2 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#3
Plasmid#106347Purposesmall guide RNA #3 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12(50-130)
Plasmid#105595Purposeretrovirally express mouse TAF12 HFD with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertTAF12 (AA 50-130)- histone fold domain-HFD (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationtruncation fragments containing aa (50-130), and …PromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA4
Plasmid#89722PurposeKnockout IRF8 in human cellsDepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA3
Plasmid#89721PurposeKnockout IRF8 in human cellsDepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LAMTOR3 gRNA (BRDN0001147669)
Plasmid#77136Purpose3rd generation lentiviral gRNA plasmid targeting human LAMTOR3DepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROT gRNA (BRDN0001145682)
Plasmid#77709Purpose3rd generation lentiviral gRNA plasmid targeting human CROTDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
KALRN gRNA (BRDN0001145005)
Plasmid#77639Purpose3rd generation lentiviral gRNA plasmid targeting human KALRNDepositorAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
NPR2 gRNA (BRDN0001148355)
Plasmid#77753Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only