We narrowed to 14,641 results for: RING;
-
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244100PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244086PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244087PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244080PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(ER).iGlucoSnFR2.HaloTag
Plasmid#244083PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(mem).iGlucoSnFR2.mRuby3
Plasmid#244089PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244084PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(ER).iGlucoSnFR2.HaloTag
Plasmid#244090PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244085PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
TagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only