We narrowed to 26,313 results for: CRISPR-Cas9
-
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-Gal80
Plasmid#169030PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-Gal80 marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mRuby-N
Plasmid#113752PurposeGateway multi-site entry clone for second position mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2
UseCRISPR; Gateway entry vectorTagsmRuby2Available SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-N
Plasmid#113747PurposeGateway multi-site entry clone for second position 2x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-3xmEGFP-N
Plasmid#113748PurposeGateway multi-site entry clone for second position 3x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags3xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-C
Plasmid#113750PurposeGateway multi-site entry clone for second position 2x mEGFP (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmRuby-N
Plasmid#113753PurposeGateway multi-site entry clone for second position 2x mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags2xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmRuby-C
Plasmid#113756PurposeGateway multi-site entry clone for second position 2x mRuby (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags2xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Human CRISPR-Cas9 Deletion Library - Trafficking, mitochondrial, motility
Pooled Library#101931PurposeBassik lab Human CRISPR-Cas9 Deletion Library - Trafficking, mitochondrial, motility. Coexpresses mCherry.DepositorExpressionMammalianUseCRISPRAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Mouse CRISPR-Cas9 Deletion Library - Trafficking, mitochondrial, motility
Pooled Library#1000000126PurposeCRISPR gRNA mouse knockout pooled library - Trafficking, mitochondrial, and motilityDepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_1
Plasmid#72371PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_2
Plasmid#72372PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF449-R.1.0-gDNA
Plasmid#132469PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF449 (ZNF449 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF302.1.0-gDNA
Plasmid#132467PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF302 (ZNF302 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF253.1.0-gDNA
Plasmid#132461PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF253 (ZNF253 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only