We narrowed to 15,935 results for: nol
-
Plasmid#162107PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-FLAG-AU1
Plasmid#162108PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-FLAG-AU1
UseLentiviralTagsVSVg-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-HA-FLAG
Plasmid#162112PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-HA-FLAG
UseLentiviralTagsStrepTagII-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-ProtC-FLAG
Plasmid#162084PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-ProtC-FLAG
UseLentiviralTagsVSVg-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-HA
Plasmid#162089PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-AU1
Plasmid#162091PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-HA
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACgp67B-Her2mP
Plasmid#10793DepositorAvailable SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
K-to-R mutant NPRL2(1-380) in pLJM60
Plasmid#184562PurposeCMV-driven expression of an untagged mutant NPRL2 (core subunit of GATOR1) — native sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.DepositorInsertNPRL2 (NPRL2 Human)
UseLentiviralExpressionMammalianMutationAll lysines were mutated to arginines.PromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:TV:Tnos (GB2048)
Plasmid#160627PurposeTU for the constitutive expression of Ms2 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-MS2:TV-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001145974)
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001146855)
Plasmid#77886Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTFP1
Plasmid#110195PurposeEncodes for human CXCR4 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162242)
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-NG-nCas9-UdgX
Plasmid#163572PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-NG-nCas9-UdgX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)NG (L111R, D1135V, G…Available SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
RIP7-RLuc-YFP-pBS
Plasmid#72482PurposeExpresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7) suitable for transfection or generation of transgenic animalsDepositorInsertsUseLuciferaseTagseYFP and renilla luciferaseExpressionMammalianMutationeYFP varientAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001145637)
Plasmid#77887Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162291)
Plasmid#77097Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only