We narrowed to 1,697 results for: CAG promoter
-
Plasmid#209190PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-1 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-2)-PGKpuro2ABFP-W
Plasmid#252916PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-1)-PGKpuro2ABFP-W
Plasmid#252915PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR2-2)-PGKpuro2ABFP-W
Plasmid#252918PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
-
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdc20
Plasmid#160954PurposeCdc20 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRho-DsRed
Plasmid#11156DepositorAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCabp5-DsRed
Plasmid#11157DepositorAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
KJ740(DE3)
Bacterial Strain#179486PurposeKJ740(DE3) is an OmpC-, OmpF-deletion strain of E. coli that allows for T7 promoter-based expressionDepositorBacterial ResistanceTetracycline (chromosome, Tn10) (10 μg/mL); Streptomycin/Spectinomycin (chromosome) (50 μg/mL)SpeciesEscherichia coliAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -hKCNJ2
Plasmid#246998PurposeCan be used to generate AAV virus that will express human KCNJ2 from EF1α core promoterDepositorAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 long
Plasmid#74469PurposeExpresses Cd99l2 transcript variant 1-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 1 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 short
Plasmid#74470PurposeExpresses Cd99l2 transcript variant 2-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 2 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only