We narrowed to 2,582 results for: pCas
-
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
MEI-S332-GFP genomic in pCaSpeR
Plasmid#113174PurposeIn P element vector for transposon insertion into Drosophila genomeDepositorInsertmei-S332 (Sgo)
UseP insertion vectorTagsGFPAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A+K855A
Plasmid#108299PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-zwf
Plasmid#87152PurposegltA1-gltA2-udhA-zwf targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-zwf guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-GapAP1
Plasmid#87151PurposegltA1-gltA2-udhA-GapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-gapAP1
Plasmid#87147PurposefabI-gltA1-gltA2-gapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(KWRQLC)-P2A-EGFP (RAS3467)
Plasmid#223112PurposepCMV and pT7 Human expression plasmid for ABE8e SpCas9 enzyme with KWRQLC amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(KWRQLC)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/KWRQLC)=D1135K, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(MKRCMV)-P2A-EGFP (BKS1030)
Plasmid#223115PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with MKRCMV amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(MKRCMV)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/MKRCMV)=D1135M, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(MKRCKS)-P2A-EGFP (RAS3455)
Plasmid#223116PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with MKRCKS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(MKRCKS)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/MKRCKS)=D1135M, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HF1-P2A-EGFP (LM422)
Plasmid#197505PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HF1(D10A/N497…PromoterCMV and T7Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HiFi-P2A-EGFP (LM446)
Plasmid#197506PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HiFi(D10A/R69…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2XNLS-SpCas9MT3-NLS-3xHA-2XNLS-NmCas9WT-2XNLS
Plasmid#107325PurposeExpresses SpCas9 (R1335K) fused to NmCas9 in mammalian cellsDepositorInsertSpCas9-NmCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1335K) is fused to NmCas9PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only