We narrowed to 14,514 results for: cas9
-
Plasmid#64940PurposeExpresses gRNA against human CREB1 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_MP01
Plasmid#194350PurposeCRISPR-Cas9 multiplexing acceptor clone with BpiI cutterDepositorInsertpcoCas9, FAST-Red
ExpressionPlantPromoterRPS5AAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-GFP_rescue_construct
Plasmid#190641PurposePuromycin-selectable expression of GFP in Drosophila S2 cellsDepositorInsertEGFP
Tags3xHAExpressionInsectPromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTJV1Sc2-tetA
Plasmid#166982PurposeGenerates ssDNA in vivo targeting tetA for recombineering w/ CspRecT recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aada for spectinomycin resistanceDepositorInsertCspRecT
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpVanCCAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458_GABPA_2
Plasmid#64255PurposeExpresses gRNA against human GABPA along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Syt1LeftArm-3XGS-GCaMP6s-SV40-3XP3-dsRed-SV40-Syt1RightArm
Plasmid#159636PurposeDonor plasmid for generating Syt1:GCaMP6s strain in Aedes aegypti with CRISPR/Cas9DepositorInsertGCaMP6s
ExpressionInsectAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Gbait-hs-QF2
Plasmid#122563PurposeIntegration of QF2 sequence using the CRISPR/Cas9 system.DepositorInsertGbait-hsp70-QF2-SV40pA
UseCloningAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_GABPA_1
Plasmid#64254PurposeExpresses gRNA against human GABPA along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Crispr-V2-HMID.v1
Plasmid#103062PurposeLentiCrisprV2 with guide targeting V1-V5 GESTALT barcodesDepositorInsertCas9 plus expressed GESTALT V1-V5 guide
UseLentiviralAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenticrispr-wt-ltr-puro
Plasmid#173428PurposeExpresses Cas9 and guide RNA, contains intact LTRDepositorInsertS. pyogenes sgRNA cassette
UseLentiviralExpressionMammalianAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_ATF1_1
Plasmid#64690PurposeExpresses gRNA against human ATF1 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Gbait-hs-Cre
Plasmid#122562PurposeIntegration of Cre sequence using the CRISPR/Cas9 system.DepositorInsertGbait-hsp70-Cre-SV40pA
UseCloningAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL1P3_AtU626Ter26
Plasmid#191771PurposeCas9 guide expression in dicotsDepositorInsertSpCas9 guide scaffold with AtU626 promoter/terminator
UseCRISPRExpressionPlantAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL11197
Plasmid#191784PurposeSpCas9 expression in plantsDepositorInsertAtUbi10::Cas9 +13 introns-T-E9
UseCRISPRExpressionPlantAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only