We narrowed to 10,976 results for: esp
-
Plasmid#129280PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHΔPPPLDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationthe last 4 amino acids (PPPL) of the KASH domain …PromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 blast OFF 3xflag IREB2
Plasmid#169889PurposeExpress 3x flag IREB2, suppressible by doxycycline additionDepositorInsertIREB2 (IREB2 Human)
UseLentiviral; Doxycycline mediated suppressionTags3x FlagExpressionMammalianMutationSilent mutations in sgIREB2_1 and sgIREB2_2 targe…PromoterTREAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A/A366S)
Plasmid#55797PurposeThis highly effective dominant negative G protein alpha-s mutant contains, in addition to the mutations in alpha-s(alpha3beta5/G226A), the A366S mutation, which increases GDP release.DepositorInsertalpha-s (alpha3beta5/G226A/A366S) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A, A366S i…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS3 (CK2alpha, CK2beta)
Plasmid#27092DepositorUseTetracycline-regulated expressionTagsHA and MycExpressionMammalianPromoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphasL-RLuc8
Plasmid#140981PurposeEncodes a G alpha subunit (GNAS1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphasL-RLuc8 (GNAS Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
cmamxA2-GFP
Plasmid#107197PurposeExpresses human annexin A2-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A2 (ANXA2 Human)
TagsGreen Fluorescent ProteinExpressionMammalianMutationall type II Ca2+ binding sites deleted ( D161A, E…PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p200 CUX1
Plasmid#90470PurposeRetroviral vector expressing human p200 CUX1 with a Myc and HA tag at the N- and C-terminus, respectivelyDepositorInsertCUX1 (CUX1 Human)
UseRetroviralTagsHa and mycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-GsCT
Plasmid#205516PurposeEndosome-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertendo-GsCT (GNAS Human, Synthetic)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eGFP-uTEV3
Plasmid#234320PurposeMammalian expression of uTEV3 tagged with an eGFP markerDepositorInserteGFP-uTEV3
UseAAVTagseGFPExpressionMammalianMutationMutations respective to the wild type TEV: S219V …PromoterCMVAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12/Cyclin K
Plasmid#231730PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hIKAROS-IRES-GFP
Plasmid#74046Purposeretroviral plasmid for expression of FLAG-tagged human Ikaros corresponding to cDNA from XM_011515058.1DepositorInserthuman Ikaros (IKZF1) (IKZF1 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK9/Cyclin T1
Plasmid#231732PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-PDGFRA-reporter
Plasmid#136456PurposeMammalian fluorescent reporter plasmid for PDGFRA signaling.DepositorInsertsPDGFRalpha (PDGFRA Human)
Array of serum response elements (SRE) to drive destabilized GFP expression from a minimal promoter.
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMV and Minimal promoter with artificial SRE enha…Available SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GNAS
Plasmid#116748PurposeLentiviral expression of GNASDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1-V16-hGDNF
Plasmid#122035PurposeAAV vector, pTet bidi (bidirectional tetracycline-responsive promoter) driving Tet-dependent rtTA and hGDNF expressionDepositorInserthGDNF (GDNF Human)
UseAAVAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_SigP:NLuc
Plasmid#197263PurposeCloning Backbone for INSPECT expression. Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via Esp3I.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
hSyn Marina-T2A-nls-mCherry
Plasmid#85843Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertGEVI Marina
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12deltaRS/Cyclin K
Plasmid#231744PurposeProtein expression in insect cellsDepositorTagsFlag-3CExpressionInsectMutationCDK12(delta104-380)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMH002_phiC31_neo-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179430PurposeDual fluorescent reporter construct with single HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-HS4-mch (SH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only