We narrowed to 10,976 results for: esp
-
Plasmid#249276PurposeExpression of Galphas (GNAS) wild type EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationInternal EE-tagPromoterEF-1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL GNAS EE T350I
Plasmid#249280PurposeExpression of Galphas T350I mutant (GNAST350I) EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationGNAS-T350I Internal EE-tagPromoterEF-1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12deltaNTD /Cyclin K
Plasmid#231741PurposeProtein expression in insect cellsDepositorTagsFlag-3CExpressionInsectMutationCDK12(700-1490)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12deltaCTD/Cyclin K
Plasmid#231742PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12-KiD/Cyclin K
Plasmid#231743PurposeProtein expression in insect cellsDepositorTagsFlag-3CExpressionInsectMutationCDK12(700-1082)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
7AA-aSyn-pRK172
Plasmid#236197PurposeThis plasmid expresses human α-synuclein with a 7-amino acid insertion (MAAAEKT) in the pRK172 backbone for bacterial expression in E. coli. The insertion corresponds to the JOS mutation.DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-HA-MycΔdeg1∆deg2
Plasmid#231243PurposeHA-tagged MYC over-expession construct with point mutations corresponding to the deletion of degron 1 and 2 for transient expression in mammalian cellsDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-Malat1
Plasmid#216858PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing Malat1 at the synapse. CIRTS-YTHDF2-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-Malat1 gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-Malat1
Plasmid#216860PurposeCIRTS RNA targeting system for targeted removal of m6A on Malat1 at the synapse. CIRTS-FTO-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-Malat1 gRNA
UseLentiviralExpressionMammalianPromoterSyn1, U6Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS FP>IA-HA-GFP
Plasmid#199688PurposeExpression of LYCHOS FP>IA mutant in insect cellsDepositorInsertLYCHOS (GPR155 Human)
Tags10xHis, 6xHis, EGFP, HA, and HRV 3CExpressionInsectMutationF43 and P44 mutated to I and A respectivelyAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLY168
Plasmid#184142PurposeReporter circuit for hijacking mRNA of arsenic responsive gene cluster as CRISPR RNA (site 2)DepositorInsertsdCas9
tetR
pspFΔHTH::λN22plus
sfgfp
rhaS
UseSynthetic BiologyTagsASV tag and λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPcon, PpspA-Ar2, PrhaB, and PtetAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-R/G-ICUE
Plasmid#181849PurposeICUE cAMP sensor using sfGFP and mRuby2 as the FRET donor and acceptor.DepositorInsertR/G-ICUE (RAPGEF3 Human)
TagsmRuby2 and sfGFPExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH005_phiC31_neo-core-5xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179433PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL008_phiC31_neo-5xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179426PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-5kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH010_phiC31_neo-5xTetO-pEF-H2B-mCitrine-1.2kb,lambda-pRSV-H2B-mCherry
Plasmid#179427PurposeDual fluorescent reporter construct with 1.2kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-1.2kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DED/AAA 535-888 USP7
Plasmid#131255PurposeMammalian expression of USP7 UBL domains 1-3, with an N-terminal Myc tag and mutations in UBL2 (corresponding to DE758AA_D764A of the full-length protein)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationA mutant form of our pcDNA3.1-N-Myc_535-888 USP7 …Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3
Plasmid#124435PurposeChimeric ETS domain: H3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis TagExpressionBacterialMutationResidues 225 to 239 replaced with corresponding s…Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only