We narrowed to 18,763 results for: STO;
-
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE1 (minus strand)
Plasmid#91842PurposeLuciferase reporter for CD69 enhancer (IGI-P0619)DepositorInsertCD69 CaRE1 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (minus strand)
Plasmid#91840PurposeLuciferase reporter for IL2RA enhancer (IGI-P0617)DepositorInsertIL2RA CaRE6 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 C>AAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (plus strand)
Plasmid#91839PurposeLuciferase reporter for IL2RA enhancer (IGI-P0616)DepositorInsertIL2RA CaRE6 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 G>T, rs11256448 A>GAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (plus strand)
Plasmid#91848PurposeLuciferase reporter for CD69 enhancer (IGI-P0625)DepositorInsertCD69 CaRE2 (plus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (minus strand)
Plasmid#91843PurposeLuciferase reporter for CD69 enhancer (IGI-P0620)DepositorInsertCD69 CaRE2 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_L (OZ535)
Plasmid#27212DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_R (OZ536)
Plasmid#27213DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pT3EF1aH-myr-Akt
Plasmid#179909PurposeThis plasmid is in the pT3-EF1a vector without loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid can be used with Cre for in vivo studies.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 nonmutant
Plasmid#183813PurposeExpress CD74-ROS1 fusion (C6;R34) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MerCreMer-hygro
Plasmid#188982PurposeRetroviral expression of tamoxifen-inducible Cre recombinaseDepositorInsertTamoxifen-inducible Cre recombinase
UseCre/Lox and RetroviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-sgTrp53-sgAtrx-EFS-Cre
Plasmid#189977PurposeExpresses Cre cDNA and sgRNAs targeting murine Trp53 and AtrxDepositorInsertsgTrp53, sgAtrx, Cre recombinase
UseAAV, Cre/Lox, and Mouse TargetingAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only