We narrowed to 14,228 results for: EGFP
-
Plasmid Kit#1000000175PurposePlasmids and Gateway entry vectors for fluorescent sensors of diverse physiological parameters in cells.DepositorAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only
-
SPLINTR GFP v1
Pooled Library#179774PurposeSPLINTR (Single-cell Profiling and LINeage TRacing) is a high diversity lentiviral barcode library for tracing clonal lineages using bulk and single-cell readouts.DepositorExpressionMammalianUseLentiviralAvailable SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human DNA Binding Domain-Focused CRISPR Knockout Library
Pooled Library#123334PurposeDesigned for genomic deletion screening of transcription factors by targeting the DNA binding domains.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralPromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-GFP
Plasmid#58977Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDA095
Plasmid#131391Purposegeneration of Tet-On RPEDepositorInsertORFeus
ExpressionMammalianAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-Trak1
Plasmid#127621PurposeN-terminal GFP-tagged mouse Trak1DepositorAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pv6_TAF3_2xPhd
Plasmid#179399PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of TAF3_2xPhdDepositorInsertTAF3_2xPhd
TagsAviTag and EGFPExpressionMammalianPromoterCAGGSAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10530
Plasmid#239266PurposeExpresses NES-dCas13b-ABI for CRISPR-TO perturbation in the cytoplasm of cell linesDepositorInsertNES-dPspCas13b-EGFP-ABI
UseCRISPR and LentiviralTagsFlag tag and V5 tagExpressionMammalianMutationH133A and H1058A in PspCas13bPromoterEF1aAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT960GFP
Plasmid#80419Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 960 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 960 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
piggyFlex
Plasmid#218234PurposeA piggyBac transposon-based gRNA expression vector, to allow for genomic integration and stable expression of gRNAs. Contains both antibiotic (puromycin) and fluorophore (GFP) markers.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i
Plasmid#233080PurposeExpression vector for sgRNA-S1b and eCas12f1iDepositorInsertU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1i-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
wt Opa1
Plasmid#204427PurposeMammalian expression plasmid of GFP-tagged hOpa1 isoform 1 protein.DepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1
Plasmid#233078PurposeExpression vector for sgRNA-S1b and eCas12f1DepositorInsertU6-sgRNA-S1b (BsaI)-CBh-bpNLS-eCas12f1-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
LAMP1-SBP-GFP
Plasmid#120172PurposeExpresses a chimera of LAMP1, SBP tag and GFP (fluorescent tag)DepositorInsertLysosomal-associated membrane protein 1 (Lamp1 Rat)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CMVwt
Plasmid#46559PurposeMammalian expression plasmid with EGFP expressed from CMV wild-type promoter.DepositorInsertCMV wt promoter
UseSynthetic BiologyExpressionMammalianMutationOur version has a G at base 724 (reference has C)PromoterCMVAvailable SinceSept. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TUBB5-Halo
Plasmid#64691PurposeExpresses beta-tubulin labeled with Halo-tagDepositorInsertTUBB
TagsHalo-tagExpressionMammalianAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only