We narrowed to 12,237 results for: nsf
-
Plasmid#207859PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.EZH2
Plasmid#125161PurposeExpresses human EZH2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSOX9-dTAG-mNeonGreen-V5
Plasmid#194971PurposeAAV vector for knocking in a C-terminal tag (dTAG-mNeonGreen-V5) for human SOX9DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Synthetic, Mouse)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-ASAP3-WPRE
Plasmid#132318Purposeexpresses ASAP3(ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vectorDepositorInsertASAP3
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCreV
Plasmid#140132Purposecan be used to generate AAV virus that will express fusion protein of split Cre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCreV
Plasmid#140131Purposecan be used to generate AAV virus that will express fusion protein of split Cre (N-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertNCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2-mt2
Plasmid#220245PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2 (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationF32A, R34A, D36A, K39A, PRKKKR494-499NAAIRSPromoterEF-1αAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 CMV 3xFG eIF4G1 +MIC
Plasmid#158776PurposepcDNA5 transfection plasmid for the exogenous expression of N-terminal 3xFlag-tagged eIF4G1 isoform including the microexon.DepositorInserteIF4G1 (with microexon)
Tags3xFlagExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Flex-FlpO
Plasmid#191202PurposeCre dependent FlpO expressionDepositorInsertFlpO
UseAAVExpressionMammalianPromoterhSynAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-Jaws-KGC-tdTomato-ER2
Plasmid#153535PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the Syn promoter.DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterSynAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LPUtopia-7
Plasmid#199212PurposeLanding Pad Utopia_v7 donor plasmid for AAVS1 site-specific integration in human cells. Use NeoR and eGFP as positive selection marker for AAVS1-targeted insertion and RFP as negative selection markerDepositorInsertsaminoglycoside phosphotransferase,
enhanced Green Fluorescence Protein
Red Fluorescence Protein
ExpressionMammalianPromoterCMV and thymidine kinase promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mCherry-Tandem-PSAM4-GlyR
Plasmid#208361PurposeExpression of the inhibitory chemogenetic tool PSAM4-GlyR and mCherry reporter. Application of ultrapotent agonists induces neuronal silencing.DepositorInsertmCherry-TANDEM-PSAM4-GlyR
UseAAVTagsmCherryExpressionMammalianPromoterCAGAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2
Plasmid#199261PurposeOptimized single AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting mouse Rosa26 gene. This optimized construct showed improved in vivo editing efficiency.DepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1a promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC469 - pAAV EF1a DIO eNpHR3.0-iRFP
Plasmid#47631PurposeAn AAV vector that expresses engineered halorhodopsin 3.0 (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserteNpHR3.0
UseAAV and Cre/LoxTagsiRFPExpressionMammalianPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4
Plasmid#173168PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4DepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sitesPromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hMECP2-cycle3GFP
Plasmid#163706PurposepAAV plasmid for Cre-dependent expression of human MECP2 fused with cycle3 GFP under Syn promoterDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only