We narrowed to 14,266 results for: crispr grnas
-
Plasmid#117635PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for Sp-eCas9 1.0(pEPOR1CB0010) and sgRNA_AtCas6 {AT5G04770}(pEPOR1CB0092)and sgRNA_AtCas6 {AT5G04770}(pEPOR1CB0103)DepositorInsert[35S:Sp-eCas9 1.0(pEPOR1CB0010) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0067
Plasmid#117634PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SpCas9-h(pICSL11023) and sgRNA_AtCas6 {AT5G04770}(pEPOR1CB0092)and sgRNA_AtCas6 {AT5G04770}(pEPOR1CB0103)DepositorInsert[35S:SpCas9-h(pICSL11023) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa3.8
Plasmid#136376PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 3.8 is usedDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa1.2
Plasmid#136373PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 1.2 is usedDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0078
Plasmid#117645PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for eSaCas9(pEPOR1CB0113), sgRNA{AT1G73460}(pEPOR1CB0099) and sgRNA{AT1G73460}(pEPOR1CB0110) to Protein kinase superfamily protein.DepositorInsert[35S:eSaCas9(pEPOR1CB0113) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0077
Plasmid#117644PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SaCas9(pEPOR1CB0015) and sgRNA_Protein kinase superfamily protein {AT1G73460}(pEPOR1CB0099)and sgRNA_Protein kinase superfamily protein {AT1G73460}(pEPOR1CB0110)DepositorInsert[35S:SaCas9(pEPOR1CB0015) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
psBIG1a ActBT2ATetP2AP - H
Plasmid#229972PurposeHarbor sgRNA+PAM sequence of ActinB gene for knockin using CRISPR and Homology Independent Targeted Integration. Contains last ActB exon fused T2A-tet regulatory elemeny-P2A-puro and HygroDepositorInsertActBT2ATetP2AP - H
UseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1a ActBT2AmcherryP2AP -TagBFPH
Plasmid#229971PurposeHarbor sgRNA+PAM sequence of ActinB gene for knockin using CRISPR and Homology Independent Targeted Integration. Contains Last ActB exon fused T2A-mCherry-P2A-puro and mTagBFPnls-T2A-HygroDepositorInsertActBT2AmcherryP2AP -TagBFPH
UseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti Cas9/SB100
Plasmid#155294PurposeLentiviral expression of Cas9 and SB100DepositorInsertSB100X-P2A-spCas9
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
LHZ1493
Plasmid#222102PurposeCloning backbone for sgRNA in Kluyveromyces marxianus. Expresses highly specific SlugCas9.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZR043_Lenti-U6-sgEGFR-MS2-PP7-hPGK-PCP-p65-HSF1-Puro
Plasmid#180267PurposeLentiviral expression vector for CRISPRa-SAM with EGFR targeting sgRNADepositorInsertEGFR sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZR047_Lenti-U6-sgGARP-MS2-PP7-hPGK-PCP-p65-HSF1-Puro
Plasmid#180268PurposeLentiviral expression vector for CRISPRa-SAM with GARP targeting sgRNADepositorInsertGARP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B1
Plasmid#172842PurposeCRISPIE donor B1 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B2
Plasmid#172843PurposeCRISPIE donor B2 (Zhong et al, eLife 2021), mRuby3 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mRuby3
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_mouse_Adar1_ccB
Plasmid#158122Purposedeletion mAdar1DepositorInsertAdar1 (Adar Mouse)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only