We narrowed to 12,237 results for: nsf
-
Plasmid#137152PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationW179FPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-miRFP
Plasmid#108416PurposeMonomeric near-infrared fluorescent protein miRFP in mammalian-expressing AAV production plasmidDepositorInsertmiRFP
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FSF-FLEX-EGFP-WPRE-bGHpA
Plasmid#65455PurposeCan be used to generate AAV virus that will express EGFP from the CAG promoter under intersectional control by Flp and Cre recombinasesDepositorInsertEGFP
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTetON-DHFRdd-SpvB; CMV-mCherry
Plasmid#89463PurposeTet/Dox-inducible expression of DHRFdd-SpvB (Salmonella SpvB 375-591) plus constitutive expression of mCherry in mammalian cells (Dual-promoter)DepositorInsertDeAct-SpvB (spvB Salmonella enterica)
TagsE. coli DHFRdd destabilization domain and mCherry…ExpressionMammalianMutationTruncation spanning SpvB amino acids 375-591 (mon…PromoterTRE3GAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-CD20-Puro
Plasmid#209757PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
Plasmid#111394PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shDyn
Plasmid#132716PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphinDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChRmine-oScarlet
Plasmid#137161PurposeIntersectional viral expression of ChRmine-p2a-oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChRmine-p2a-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationoScarlet E95DPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-hsChRmine-oScarlet-Kv2.1-WPRE
Plasmid#183527PurposeOptogeneticsDepositorInserthsChRmine-oScarlet-Kv2.1
UseAAVMutationH33RPromoterEf1aAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMS-dsRed2-WT LMNA-GFP minigene
Plasmid#128230PurposeLamin A splicing reporterDepositorInsertlamin A (LMNA Human)
TagsGFP and SV40-driven dsRed2 to identify transfecte…ExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{hM4Di-mCherry}on-W3SL
Plasmid#111397PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON hM4Di-mCherry (Gi-coupled DREADD for neuronal silencing), W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsMyc and mCherryExpressionMammalianPromoterhSynapsinAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC(F198Y)
Plasmid#234548Purposeto express a version with reduced constitutive activity (thanks to point mutation F198Y) of the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC(F198Y)
UseAAVMutationF198YPromotermGFAP(ABC1D)Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY088_AAV_EFS-BCMA-41BBz-PRODH2
Plasmid#192191PurposeBCMA CAR AAV vector PRODH2 KI (pLY088)DepositorInsertBCMA CAR AAV vector PRODH2 KI (pLY088) (TNFRSF17 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-fCX3CL1
Plasmid#164421PurposeAAV plasmid expressing full-length CX3CL1 (fractalkine) in photoreceptorsDepositorAvailable SinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2(ET/TC)-EYFP
Plasmid#137141PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6M
Plasmid#137120PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only