We narrowed to 11,585 results for: AGA
-
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(SOD1)
Plasmid#109321PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human SOD1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162236)
Plasmid#76309Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001145259)
Plasmid#77734Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001147538)
Plasmid#77735Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-Puro
Plasmid#215362PurposeExpresses a rat Letm1 specific shRNADepositorInsertLetm1 shRNA Target sequence (Letm1 Rat)
UseLentiviralAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-mTagBFP2
Plasmid#215363PurposeExpresses a rat Letm1 specific shRNA and a BFP under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-miRFPnano
Plasmid#215365PurposeExpresses a rat Letm1 specific shRNA and miRFPnano under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgLIAS-1
Plasmid#251681PurposegRNA to knock out LIAS in mammalian cellsDepositorInsertLIAS lipoic acid synthetase (LIAS Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-1
Plasmid#251685PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-2
Plasmid#251686PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
Plasmid#208348PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_2b)-PGKpuro2ABFP-W
Plasmid#208417PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits